EMAIL THIS PAGE TO A FRIEND

F13A1

coagulation factor XIII, A1 polypeptide

176 Gene Product Result for
Synonyms: F13A
UniProtKB ID: P00488, Q59HA7, Q8N6X2, Q96P24, Q9BX29
Gene ID:
Human(2162) Summary: This gene encodes the coagulation factor XIII A subunit. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as plasma carrier molecules. Platelet factor XIII is comprised only of 2 A subunits, which are identical to those of plasma origin. Upon cleavage of the activation peptide by thrombin and in the presence of calcium ion, the plasma factor XIII dissociates its B subunits and yields the same active enzyme, factor XIIIa, as platelet factor XIII. This enzyme acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. It also crosslinks alpha-2-plasmin inhibitor, or fibronectin, to the alpha chains of fibrin. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits; and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. [provided by RefSeq, Jul 2008]
Mouse(74145) coagulation factor XIII, A1 subunit
Rat(60327) coagulation factor XIII, A1 polypeptide
chicken(395420) coagulation factor XIII, A1 polypeptide
domestic cat(101080534) coagulation factor XIII, A1 polypeptide
cow(617881) coagulation factor XIII, A1 polypeptide
Horse(100060428) coagulation factor XIII, A1 polypeptide
dog(478711) coagulation factor XIII, A1 polypeptide
sheep(101108612) coagulation factor XIII, A1 polypeptide
naked mole-rat(101715346) coagulation factor XIII, A1 polypeptide
domestic guinea pig(100719684) coagulation factor XIII, A1 polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0482 AQUA Peptide LSIQSSP[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000129 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000129 Rosetta Predictions human pricing
NM_021698 Rosetta Predictions rat pricing
NM_028784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178485 predicted 297
2 SASI_Hs01_00178486 predicted 1995
3 SASI_Hs01_00178487 predicted 1653
4 SASI_Hs01_00178488 predicted 474
5 SASI_Hs01_00178489 predicted 2343
6 SASI_Hs01_00178490 predicted 1760
7 SASI_Hs02_00301932 predicted 452
8 SASI_Hs02_00301933 predicted 2127
9 SASI_Hs02_00301934 predicted 2393
10 SASI_Hs01_00178491 predicted 1033
11 SASI_Hs01_00178492 predicted 1569
12 SASI_Hs01_00178493 predicted 1166
13 SASI_Hs01_00178494 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079712 predicted 2297
2 SASI_Rn02_00262740 predicted 1071
3 SASI_Rn01_00079714 predicted 2239
4 SASI_Rn01_00079715 predicted 1538
5 SASI_Rn02_00262741 predicted 634
6 SASI_Rn01_00079717 predicted 1494
7 SASI_Rn01_00079718 predicted 2037
8 SASI_Rn01_00079719 predicted 1844
9 SASI_Rn01_00079720 predicted 1760
10 SASI_Rn01_00079721 predicted 847
11 SASI_Rn01_00079713 predicted 880
12 SASI_Rn01_00079716 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100468 predicted 889
2 SASI_Mm01_00100469 predicted 1781
3 SASI_Mm01_00100470 predicted 1633
4 SASI_Mm01_00100471 predicted 2255
5 SASI_Mm01_00100472 predicted 1110
6 SASI_Mm01_00100473 predicted 1507
7 SASI_Mm01_00100474 predicted 413
8 SASI_Mm01_00100475 predicted 1856
9 SASI_Mm01_00100476 predicted 2030
10 SASI_Mm01_00100477 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000129
F13A1 MISSION shRNA Bacterial Glycerol Stock
coagulation factor XIII, A1 polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1095s1c1
Sequence:CCGGCCAGCAAGAATTGTTACCAATCTCGAGATTGGTAACAATTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-341s1c1
Sequence:CCGGGCAGTCTTTCTATGTGCAGATCTCGAGATCTGCACATAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1473s1c1
Sequence:CCGGGCCACCCACATTGGGAAATTACTCGAGTAATTTCCCAATGTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1056s1c1
Sequence:CCGGGCTGGTGTCTTTAACACATTTCTCGAGAAATGTGTTAAAGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-988s1c1
Sequence:CCGGGCGTTGACATTCTATTGGAATCTCGAGATTCCAATAGAATGTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000129.3-2565s21c1
Sequence:CCGGTTAAGCTCTCATAGCTCATAACTCGAGTTATGAGCTATGAGAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000129.3-166s21c1
Sequence:CCGGGTTCCACCCAATAACTCTAATCTCGAGATTAGAGTTATTGGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000129.3-1538s21c1
Sequence:CCGGGAGATGGCATGATGGATATTACTCGAGTAATATCCATCATGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000129
F13A1 MISSION shRNA shRNA Plasmid DNA
coagulation factor XIII, A1 polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1095s1c1
Sequence:CCGGCCAGCAAGAATTGTTACCAATCTCGAGATTGGTAACAATTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-341s1c1
Sequence:CCGGGCAGTCTTTCTATGTGCAGATCTCGAGATCTGCACATAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1473s1c1
Sequence:CCGGGCCACCCACATTGGGAAATTACTCGAGTAATTTCCCAATGTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1056s1c1
Sequence:CCGGGCTGGTGTCTTTAACACATTTCTCGAGAAATGTGTTAAAGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-988s1c1
Sequence:CCGGGCGTTGACATTCTATTGGAATCTCGAGATTCCAATAGAATGTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000129.3-2565s21c1
Sequence:CCGGTTAAGCTCTCATAGCTCATAACTCGAGTTATGAGCTATGAGAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000129.3-166s21c1
Sequence:CCGGGTTCCACCCAATAACTCTAATCTCGAGATTAGAGTTATTGGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000129.3-1538s21c1
Sequence:CCGGGAGATGGCATGATGGATATTACTCGAGTAATATCCATCATGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000129
F13A1 MISSION shRNA Lentiviral Transduction Particles
coagulation factor XIII, A1 polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1095s1c1
Sequence:CCGGCCAGCAAGAATTGTTACCAATCTCGAGATTGGTAACAATTCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-341s1c1
Sequence:CCGGGCAGTCTTTCTATGTGCAGATCTCGAGATCTGCACATAGAAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1473s1c1
Sequence:CCGGGCCACCCACATTGGGAAATTACTCGAGTAATTTCCCAATGTGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-1056s1c1
Sequence:CCGGGCTGGTGTCTTTAACACATTTCTCGAGAAATGTGTTAAAGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000129.2-988s1c1
Sequence:CCGGGCGTTGACATTCTATTGGAATCTCGAGATTCCAATAGAATGTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000129.3-2565s21c1
Sequence:CCGGTTAAGCTCTCATAGCTCATAACTCGAGTTATGAGCTATGAGAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000129.3-166s21c1
Sequence:CCGGGTTCCACCCAATAACTCTAATCTCGAGATTAGAGTTATTGGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000129.3-1538s21c1
Sequence:CCGGGAGATGGCATGATGGATATTACTCGAGTAATATCCATCATGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028784
F13A1 MISSION shRNA Bacterial Glycerol Stock
coagulation factor XIII, A1 polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028784.2-2906s1c1
Sequence:CCGGCCCACATTAACAAATTGCATTCTCGAGAATGCAATTTGTTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1384s1c1
Sequence:CCGGGCAGAGGTCAACAGTGATCTTCTCGAGAAGATCACTGTTGACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1566s1c1
Sequence:CCGGCCTTGAAACTGCTCTGATGTACTCGAGTACATCAGAGCAGTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1467s1c1
Sequence:CCGGCGGGAAGCTAATTGTGACCAACTCGAGTTGGTCACAATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-702s1c1
Sequence:CCGGCCTGAATGACATTGGAGTGATCTCGAGATCACTCCAATGTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028784
F13A1 MISSION shRNA shRNA Plasmid DNA
coagulation factor XIII, A1 polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028784.2-2906s1c1
Sequence:CCGGCCCACATTAACAAATTGCATTCTCGAGAATGCAATTTGTTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1384s1c1
Sequence:CCGGGCAGAGGTCAACAGTGATCTTCTCGAGAAGATCACTGTTGACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1566s1c1
Sequence:CCGGCCTTGAAACTGCTCTGATGTACTCGAGTACATCAGAGCAGTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1467s1c1
Sequence:CCGGCGGGAAGCTAATTGTGACCAACTCGAGTTGGTCACAATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-702s1c1
Sequence:CCGGCCTGAATGACATTGGAGTGATCTCGAGATCACTCCAATGTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028784
F13A1 MISSION shRNA Lentiviral Transduction Particles
coagulation factor XIII, A1 polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028784.2-2906s1c1
Sequence:CCGGCCCACATTAACAAATTGCATTCTCGAGAATGCAATTTGTTAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1384s1c1
Sequence:CCGGGCAGAGGTCAACAGTGATCTTCTCGAGAAGATCACTGTTGACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1566s1c1
Sequence:CCGGCCTTGAAACTGCTCTGATGTACTCGAGTACATCAGAGCAGTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-1467s1c1
Sequence:CCGGCGGGAAGCTAATTGTGACCAACTCGAGTTGGTCACAATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028784.2-702s1c1
Sequence:CCGGCCTGAATGACATTGGAGTGATCTCGAGATCACTCCAATGTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks