EMAIL THIS PAGE TO A FRIEND

F13B

coagulation factor XIII, B polypeptide

51 Gene Product Result for
Synonyms: FXIIIB
UniProtKB ID: P05160, A8K3E5, Q5VYL5
Gene ID:
Human(2165) Summary: This gene encodes coagulation factor XIII B subunit. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as a plasma carrier molecules. Platelet factor XIII is comprised only of 2 A subunits, which are identical to those of plasma origin. Upon activation by the cleavage of the activation peptide by thrombin and in the presence of calcium ion, the plasma factor XIII dissociates its B subunits and yields the same active enzyme, factor XIIIa, as platelet factor XIII. This enzyme acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits; and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. [provided by RefSeq, Jul 2008]
Mouse(14060) coagulation factor XIII, beta subunit
Rat(289055) coagulation factor XIII, B polypeptide
Zebrafish(100329235) coagulation factor XIII, B polypeptide
domestic cat(101091588) coagulation factor XIII, B polypeptide
cow(511483) coagulation factor XIII, B polypeptide
Horse(100060602) coagulation factor XIII, B polypeptide
dog(490261) coagulation factor XIII, B polypeptide
chicken(424355) coagulation factor XIII, B polypeptide
domestic guinea pig(100733621) coagulation factor XIII, B polypeptide
naked mole-rat(101714935) coagulation factor XIII, B polypeptide
sheep(101122712) coagulation factor XIII, B polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001994 Rosetta Predictions human pricing
NM_001105956 Rosetta Predictions rat pricing
NM_031164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074193 predicted 781
2 SASI_Hs01_00074194 predicted 314
3 SASI_Hs01_00074195 predicted 1080
4 SASI_Hs01_00074197 predicted 332
5 SASI_Hs01_00074198 predicted 1388
6 SASI_Hs01_00074199 predicted 1507
7 SASI_Hs01_00074200 predicted 559
8 SASI_Hs02_00332983 predicted 423
9 SASI_Hs01_00074202 predicted 627
10 SASI_Hs02_00332984 predicted 1723
11 SASI_Hs01_00074196 predicted 1182
12 SASI_Hs01_00074201 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214202 predicted 784
2 SASI_Rn02_00214203 predicted 1433
3 SASI_Rn02_00214204 predicted 502
4 SASI_Rn02_00214205 predicted 1447
5 SASI_Rn02_00214206 predicted 1217
6 SASI_Rn02_00214207 predicted 1056
7 SASI_Rn02_00214208 predicted 861
8 SASI_Rn02_00214209 predicted 806
9 SASI_Rn02_00214210 predicted 1569
10 SASI_Rn02_00214211 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100364 predicted 886
2 SASI_Mm01_00100365 predicted 1745
3 SASI_Mm01_00100366 predicted 2117
4 SASI_Mm02_00336986 predicted 758
5 SASI_Mm01_00100367 predicted 1394
6 SASI_Mm01_00100368 predicted 1087
7 SASI_Mm01_00100369 predicted 801
8 SASI_Mm01_00100370 predicted 258
9 SASI_Mm01_00100371 predicted 1379
10 SASI_Mm01_00100372 predicted 539
11 SASI_Mm01_00100373 predicted 2074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001994
F13B MISSION shRNA Bacterial Glycerol Stock
coagulation factor XIII, B polypeptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001994.2-1260s21c1
Sequence:CCGGGCTGTTGCAGACGGGATATTGCTCGAGCAATATCCCGTCTGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001994.2-1949s21c1
Sequence:CCGGATGTGACAGAGGGCAGTTAAACTCGAGTTTAACTGCCCTCTGTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001994.1-2029s1c1
Sequence:CCGGTGGCAGAAAGAGGAGTCATATCTCGAGATATGACTCCTCTTTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-1966s1c1
Sequence:CCGGCAAGATGTATTCCAAGACAAACTCGAGTTTGTCTTGGAATACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-314s1c1
Sequence:CCGGGCCTGACCTGAGTAATGGTTACTCGAGTAACCATTACTCAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-1965s1c1
Sequence:CCGGCCAAGATGTATTCCAAGACAACTCGAGTTGTCTTGGAATACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-469s1c1
Sequence:CCGGCCTGTAGGAAAGAACATGAAACTCGAGTTTCATGTTCTTTCCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001994
F13B MISSION shRNA shRNA Plasmid DNA
coagulation factor XIII, B polypeptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001994.2-1260s21c1
Sequence:CCGGGCTGTTGCAGACGGGATATTGCTCGAGCAATATCCCGTCTGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001994.2-1949s21c1
Sequence:CCGGATGTGACAGAGGGCAGTTAAACTCGAGTTTAACTGCCCTCTGTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001994.1-2029s1c1
Sequence:CCGGTGGCAGAAAGAGGAGTCATATCTCGAGATATGACTCCTCTTTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-1966s1c1
Sequence:CCGGCAAGATGTATTCCAAGACAAACTCGAGTTTGTCTTGGAATACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-314s1c1
Sequence:CCGGGCCTGACCTGAGTAATGGTTACTCGAGTAACCATTACTCAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-1965s1c1
Sequence:CCGGCCAAGATGTATTCCAAGACAACTCGAGTTGTCTTGGAATACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-469s1c1
Sequence:CCGGCCTGTAGGAAAGAACATGAAACTCGAGTTTCATGTTCTTTCCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001994
F13B MISSION shRNA Lentiviral Transduction Particles
coagulation factor XIII, B polypeptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001994.2-1260s21c1
Sequence:CCGGGCTGTTGCAGACGGGATATTGCTCGAGCAATATCCCGTCTGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001994.2-1949s21c1
Sequence:CCGGATGTGACAGAGGGCAGTTAAACTCGAGTTTAACTGCCCTCTGTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001994.1-2029s1c1
Sequence:CCGGTGGCAGAAAGAGGAGTCATATCTCGAGATATGACTCCTCTTTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-1966s1c1
Sequence:CCGGCAAGATGTATTCCAAGACAAACTCGAGTTTGTCTTGGAATACATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-314s1c1
Sequence:CCGGGCCTGACCTGAGTAATGGTTACTCGAGTAACCATTACTCAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-1965s1c1
Sequence:CCGGCCAAGATGTATTCCAAGACAACTCGAGTTGTCTTGGAATACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001994.1-469s1c1
Sequence:CCGGCCTGTAGGAAAGAACATGAAACTCGAGTTTCATGTTCTTTCCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031164
F13B MISSION shRNA Bacterial Glycerol Stock
coagulation factor XIII, B polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031164.1-2074s1c1
Sequence:CCGGGACTCCACTAAGTTCAGTGTTCTCGAGAACACTGAACTTAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-487s1c1
Sequence:CCGGCCCTGAGTTGGAACATGGAAACTCGAGTTTCCATGTTCCAACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-1662s1c1
Sequence:CCGGCCTCAGTAGAATACCGGTGTTCTCGAGAACACCGGTATTCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-488s1c1
Sequence:CCGGCCTGAGTTGGAACATGGAAATCTCGAGATTTCCATGTTCCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-1379s1c1
Sequence:CCGGCCCTGCACTATTGATGTGGATCTCGAGATCCACATCAATAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031164
F13B MISSION shRNA shRNA Plasmid DNA
coagulation factor XIII, B polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031164.1-2074s1c1
Sequence:CCGGGACTCCACTAAGTTCAGTGTTCTCGAGAACACTGAACTTAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-487s1c1
Sequence:CCGGCCCTGAGTTGGAACATGGAAACTCGAGTTTCCATGTTCCAACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-1662s1c1
Sequence:CCGGCCTCAGTAGAATACCGGTGTTCTCGAGAACACCGGTATTCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-488s1c1
Sequence:CCGGCCTGAGTTGGAACATGGAAATCTCGAGATTTCCATGTTCCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-1379s1c1
Sequence:CCGGCCCTGCACTATTGATGTGGATCTCGAGATCCACATCAATAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031164
F13B MISSION shRNA Lentiviral Transduction Particles
coagulation factor XIII, B polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031164.1-2074s1c1
Sequence:CCGGGACTCCACTAAGTTCAGTGTTCTCGAGAACACTGAACTTAGTGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-487s1c1
Sequence:CCGGCCCTGAGTTGGAACATGGAAACTCGAGTTTCCATGTTCCAACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-1662s1c1
Sequence:CCGGCCTCAGTAGAATACCGGTGTTCTCGAGAACACCGGTATTCTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-488s1c1
Sequence:CCGGCCTGAGTTGGAACATGGAAATCTCGAGATTTCCATGTTCCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031164.1-1379s1c1
Sequence:CCGGCCCTGCACTATTGATGTGGATCTCGAGATCCACATCAATAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks