EMAIL THIS PAGE TO A FRIEND

F2

coagulation factor II (thrombin)

Synonyms: PT RPRGL2 THPH1
Gene ID:
Human(2147) Summary: Coagulation factor II is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. F2 also plays a role in maintaining vascular integrity during development and postnatal life. Mutations in F2 leads to various forms of thrombosis and dysprothrombinemia. [provided by RefSeq, Jul 2008]
Mouse(14061) coagulation factor II
Rat(29251) coagulation factor II
Zebrafish(325881) coagulation factor II (thrombin)
cow(280685) coagulation factor II (thrombin)
domestic cat(101090463) coagulation factor II (thrombin)
dog(100686115) coagulation factor II (thrombin)
chicken(395306) coagulation factor II (thrombin)
sheep(100307041) coagulation factor II (thrombin)
naked mole-rat(101720561) coagulation factor II (thrombin)
domestic guinea pig(100725988) coagulation factor II (thrombin)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F5681 Anti-F2 (131-145) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F5806 Anti-F2 (316-330) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405777 Anti-F2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2100739 Anti-F2 antibody produced in rabbit affinity isolated antibody mouse, bovine, canine, human, horse, zebrafish, rat, guinea pig, pig
western blot pricing
HPA051476 Anti-F2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA054698 Anti-F2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106564 Anti-F2 antibody produced in rabbit affinity isolated antibody sheep, human, rat, horse, rabbit, guinea pig
ELISA, western blot pricing
GW20092F Anti-Prothrombin antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4500821 Anti-THRB (AP2, Cleaved-Arg327) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4500820 Anti-THRB antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
WH0002147M1 Monoclonal Anti-F2 antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP6556 Thrombin Active (High Activity) from bovine plasma ≥98% (SDS-PAGE) bovine pricing
SRP6555 Thrombin Active (Technical grade) from bovine plasma ≥98% (SDS-PAGE) bovine pricing
T4648 Thrombin from bovine plasma lyophilized powder, 40-300 NIH units/mg protein (biuret) cow pricing
T7513 Thrombin from bovine plasma lyophilized powder, ≥2,000 NIH units/mg protein (E1%/280 = 19.5) cow pricing
T6634 Thrombin from bovine plasma lyophilized powder, 600-2,000 NIH units/mg protein (biuret) cow pricing
T9549 Thrombin from bovine plasma powder, cell culture tested, ≥1,500 NIH units/mg protein (E1%/280 = 19.5) cow pricing
T9681 Thrombin from bovine plasma lyophilized powder, ≥700 NIH units/mg protein (Bradford) cow pricing
T9000 Thrombin from bovine plasma buffered aqueous solution, ≥125 NIH units/mg protein (biuret) cow pricing
APREST85773 PrEST Antigen F2 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
APREST85774 PrEST Antigen F2 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
SRP6557 Thrombin Active from human plasma ≥95% (SDS-PAGE) human pricing
T6884 Thrombin from human plasma lyophilized powder, ≥2,000 NIH units/mg protein (E1%/280, 18.3) human pricing
T7009 Thrombin from human plasma lyophilized powder, ≥1,000 NIH units/mg protein (E1%/280, 18.3) human pricing
T1063 Thrombin from human plasma lyophilized powder, ≥2800 NIH units/mg protein (E1%/280, 18.3) human pricing
T8885 Thrombin from human plasma lyophilized powder, Suitable for routine use in the thrombin time test human pricing
T4393 Thrombin from human plasma lyophilized powder, 1500-3500 NIH units/mg protein (E1%/280, 18.3), cell culture tested human pricing
T9135 Thrombin from human plasma lyophilized powder human pricing
T7572 Thrombin from human plasma 400-1000 NIH units/mg protein human pricing
T9326 Thrombin human BioUltra, recombinant, expressed in HEK 293 cells, aqueous solution, ≥95% (SDS-PAGE) human pricing
SAE0006 Thrombin human recombinant, expressed in HEK 293 cells, aqueous solution, ≥95% (SDS-PAGE) human pricing
T5772 Thrombin from rat plasma lyophilized powder, ≥1,000 units/mg protein (biuret) human, rat pricing
T8397 Thrombin from murine plasma lyophilized powder, ~1,000 NIH units/mg protein (biuret) mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000506 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038181 MISSION® esiRNA esiRNA human F2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000506 Rosetta Predictions human pricing
NM_022924 Rosetta Predictions rat pricing
NM_010168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302687 predicted 885
2 SASI_Hs01_00210723 predicted 989
3 SASI_Hs02_00302688 predicted 996
4 SASI_Hs01_00210724 predicted 1331
5 SASI_Hs01_00210725 predicted 999
6 SASI_Hs02_00302689 predicted 984
7 SASI_Hs01_00210726 predicted 1461
8 SASI_Hs01_00210727 predicted 1287
9 SASI_Hs01_00210728 predicted 344
10 SASI_Hs01_00210729 predicted 447
11 SASI_Hs01_00210730 predicted 1444
12 SASI_Hs01_00210731 predicted 1079
13 SASI_Hs01_00210732 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263615 predicted 1532
2 SASI_Rn01_00050694 predicted 740
3 SASI_Rn01_00050695 predicted 1349
4 SASI_Rn01_00050696 predicted 1465
5 SASI_Rn01_00050697 predicted 686
6 SASI_Rn01_00050699 predicted 1292
7 SASI_Rn01_00050700 predicted 256
8 SASI_Rn01_00050701 predicted 1375
9 SASI_Rn01_00050702 predicted 270
10 SASI_Rn01_00050703 predicted 349
11 SASI_Rn01_00050698 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061009 predicted 688
2 SASI_Mm01_00061007 predicted 1539
3 SASI_Mm01_00061008 predicted 1298
4 SASI_Mm02_00317933 predicted 1298
5 SASI_Mm01_00061010 predicted 345
6 SASI_Mm01_00061011 predicted 1745
7 SASI_Mm01_00061012 predicted 1042
8 SASI_Mm01_00061013 predicted 371
9 SASI_Mm01_00061014 predicted 271
10 SASI_Mm01_00061015 predicted 1631
11 SASI_Mm01_00061016 predicted 1395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010168
F2 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-677s1c1
Sequence:CCGGGCCGACTATACCAAGGGAATTCTCGAGAATTCCCTTGGTATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1300s1c1
Sequence:CCGGCGAACCAGATATGAGCGGAATCTCGAGATTCCGCTCATATCTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1750s1c1
Sequence:CCGGCGCTGGTATCAAATGGGTATTCTCGAGAATACCCATTTGATACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1420s1c1
Sequence:CCGGCCTGTACCCTTCAGTGACTATCTCGAGATAGTCACTGAAGGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-756s1c1
Sequence:CCGGCCTGAGCAAGTACCAAGACTTCTCGAGAAGTCTTGGTACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010168
F2 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-677s1c1
Sequence:CCGGGCCGACTATACCAAGGGAATTCTCGAGAATTCCCTTGGTATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1300s1c1
Sequence:CCGGCGAACCAGATATGAGCGGAATCTCGAGATTCCGCTCATATCTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1750s1c1
Sequence:CCGGCGCTGGTATCAAATGGGTATTCTCGAGAATACCCATTTGATACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1420s1c1
Sequence:CCGGCCTGTACCCTTCAGTGACTATCTCGAGATAGTCACTGAAGGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-756s1c1
Sequence:CCGGCCTGAGCAAGTACCAAGACTTCTCGAGAAGTCTTGGTACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010168
F2 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-677s1c1
Sequence:CCGGGCCGACTATACCAAGGGAATTCTCGAGAATTCCCTTGGTATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1300s1c1
Sequence:CCGGCGAACCAGATATGAGCGGAATCTCGAGATTCCGCTCATATCTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1750s1c1
Sequence:CCGGCGCTGGTATCAAATGGGTATTCTCGAGAATACCCATTTGATACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-1420s1c1
Sequence:CCGGCCTGTACCCTTCAGTGACTATCTCGAGATAGTCACTGAAGGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010168.1-756s1c1
Sequence:CCGGCCTGAGCAAGTACCAAGACTTCTCGAGAAGTCTTGGTACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000506
F2 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-335s1c1
Sequence:CCGGGCATGTCTGGAAGGTAACTGTCTCGAGACAGTTACCTTCCAGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000506.x-1926s1c1
Sequence:CCGGGAACCAATCCCGTGAAAGAATCTCGAGATTCTTTCACGGGATTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-1861s1c1
Sequence:CCGGGAAGTGGATACAGAAGGTCATCTCGAGATGACCTTCTGTATCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-439s1c1
Sequence:CCGGCCCACATAAGCCTGAAATCAACTCGAGTTGATTTCAGGCTTATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-1865s1c1
Sequence:CCGGTGGATACAGAAGGTCATTGATCTCGAGATCAATGACCTTCTGTATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-894s21c1
Sequence:CCGGGGTACTGCGACCTCAACTATTCTCGAGAATAGTTGAGGTCGCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-1823s21c1
Sequence:CCGGTGTGACCGGGATGGGAAATATCTCGAGATATTTCCCATCCCGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-1777s21c1
Sequence:CCGGTAACAACCGCTGGTATCAAATCTCGAGATTTGATACCAGCGGTTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000506
F2 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-335s1c1
Sequence:CCGGGCATGTCTGGAAGGTAACTGTCTCGAGACAGTTACCTTCCAGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000506.x-1926s1c1
Sequence:CCGGGAACCAATCCCGTGAAAGAATCTCGAGATTCTTTCACGGGATTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-1861s1c1
Sequence:CCGGGAAGTGGATACAGAAGGTCATCTCGAGATGACCTTCTGTATCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-439s1c1
Sequence:CCGGCCCACATAAGCCTGAAATCAACTCGAGTTGATTTCAGGCTTATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-1865s1c1
Sequence:CCGGTGGATACAGAAGGTCATTGATCTCGAGATCAATGACCTTCTGTATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-894s21c1
Sequence:CCGGGGTACTGCGACCTCAACTATTCTCGAGAATAGTTGAGGTCGCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-1823s21c1
Sequence:CCGGTGTGACCGGGATGGGAAATATCTCGAGATATTTCCCATCCCGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-1777s21c1
Sequence:CCGGTAACAACCGCTGGTATCAAATCTCGAGATTTGATACCAGCGGTTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000506
F2 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-335s1c1
Sequence:CCGGGCATGTCTGGAAGGTAACTGTCTCGAGACAGTTACCTTCCAGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000506.x-1926s1c1
Sequence:CCGGGAACCAATCCCGTGAAAGAATCTCGAGATTCTTTCACGGGATTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-1861s1c1
Sequence:CCGGGAAGTGGATACAGAAGGTCATCTCGAGATGACCTTCTGTATCCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-439s1c1
Sequence:CCGGCCCACATAAGCCTGAAATCAACTCGAGTTGATTTCAGGCTTATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000506.x-1865s1c1
Sequence:CCGGTGGATACAGAAGGTCATTGATCTCGAGATCAATGACCTTCTGTATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-894s21c1
Sequence:CCGGGGTACTGCGACCTCAACTATTCTCGAGAATAGTTGAGGTCGCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-1823s21c1
Sequence:CCGGTGTGACCGGGATGGGAAATATCTCGAGATATTTCCCATCCCGGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000506.3-1777s21c1
Sequence:CCGGTAACAACCGCTGGTATCAAATCTCGAGATTTGATACCAGCGGTTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks