EMAIL THIS PAGE TO A FRIEND

F2R

coagulation factor II (thrombin) receptor

77 Gene Product Result for
Synonyms: CF2R HTR PAR-1 PAR1 TR
UniProtKB ID: P25116, Q53XV0, Q96RF7, Q9BUN4
Gene ID:
Human(2149) Summary: Coagulation factor II receptor is a 7-transmembrane receptor involved in the regulation of thrombotic response. Proteolytic cleavage leads to the activation of the receptor. F2R is a G-protein coupled receptor family member. [provided by RefSeq, Jul 2008]
Mouse(14062) coagulation factor II (thrombin) receptor
Rat(25439) coagulation factor II (thrombin) receptor
Zebrafish(558477) coagulation factor II (thrombin) receptor
domestic cat(101100861) coagulation factor II (thrombin) receptor
cow(526585) coagulation factor II (thrombin) receptor
dog(488942) coagulation factor II (thrombin) receptor
chicken(427212) coagulation factor II (thrombin) receptor
domestic guinea pig(100719323) coagulation factor II (thrombin) receptor
sheep(101105757) coagulation factor II (thrombin) receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

3'UTR GoClone

Product # Description Species Add to Cart
 
HUTR14349 MISSION® 3′UTR Lenti GoClone human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000271 MISSION® esiRNA esiRNA targeting human F2R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001992 Rosetta Predictions human pricing
NM_012950 Rosetta Predictions rat pricing
NM_010169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240436 predicted 528
2 SASI_Hs01_00240437 predicted 1055
3 SASI_Hs01_00240438 predicted 1105
4 SASI_Hs01_00240440 predicted 466
5 SASI_Hs01_00240441 predicted 1126
6 SASI_Hs01_00240442 predicted 1361
7 SASI_Hs01_00240443 predicted 612
8 SASI_Hs01_00240444 predicted 846
9 SASI_Hs01_00240445 predicted 829
10 SASI_Hs02_00332980 predicted 1136
11 SASI_Hs01_00240439 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260526 predicted 1512
2 SASI_Rn02_00260527 predicted 1505
3 SASI_Rn02_00260528 predicted 1611
4 SASI_Rn02_00260529 predicted 644
5 SASI_Rn02_00260530 predicted 1256
6 SASI_Rn02_00260531 predicted 1609
7 SASI_Rn02_00260532 predicted 994
8 SASI_Rn02_00260533 predicted 881
9 SASI_Rn02_00260534 predicted 1429
10 SASI_Rn02_00260535 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100728 predicted 1063
2 SASI_Mm01_00100729 predicted 1458
3 SASI_Mm01_00100730 predicted 1469
4 SASI_Mm01_00100731 predicted 1308
5 SASI_Mm01_00100732 predicted 983
6 SASI_Mm01_00100733 predicted 1461
7 SASI_Mm01_00100734 predicted 544
8 SASI_Mm02_00317934 predicted 1117
9 SASI_Mm01_00100736 predicted 633
10 SASI_Mm02_00317935 predicted 1480
11 SASI_Mm01_00100735 predicted 1601
12 SASI_Mm01_00100737 predicted 1500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001992
F2R MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1247s21c1
Sequence:CCGGCCCACAAACGTCCTCCTGATTCTCGAGAATCAGGAGGACGTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1270s21c1
Sequence:CCGGGCATTACTCATTCCTTTCTCACTCGAGTGAGAAAGGAATGAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-384s21c1
Sequence:CCGGCCCGGTCATTTCTTCTCAGGACTCGAGTCCTGAGAAGAAATGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1068s21c1
Sequence:CCGGCCTACTACTTCTCAGCCTTCTCTCGAGAGAAGGCTGAGAAGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1326s1c1
Sequence:CCGGCCCACAAACGTCCTCCTGATTCTCGAGAATCAGGAGGACGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1147s1c1
Sequence:CCGGCCTACTACTTCTCAGCCTTCTCTCGAGAGAAGGCTGAGAAGTAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001992.x-2152s1c1
Sequence:CCGGGACGGCAAGGTTTAAGTTATTCTCGAGAATAACTTAAACCTTGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-463s1c1
Sequence:CCGGCCCGGTCATTTCTTCTCAGGACTCGAGTCCTGAGAAGAAATGACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1349s1c1
Sequence:CCGGGCATTACTCATTCCTTTCTCACTCGAGTGAGAAAGGAATGAGTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001992
F2R MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1247s21c1
Sequence:CCGGCCCACAAACGTCCTCCTGATTCTCGAGAATCAGGAGGACGTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1270s21c1
Sequence:CCGGGCATTACTCATTCCTTTCTCACTCGAGTGAGAAAGGAATGAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-384s21c1
Sequence:CCGGCCCGGTCATTTCTTCTCAGGACTCGAGTCCTGAGAAGAAATGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1068s21c1
Sequence:CCGGCCTACTACTTCTCAGCCTTCTCTCGAGAGAAGGCTGAGAAGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1326s1c1
Sequence:CCGGCCCACAAACGTCCTCCTGATTCTCGAGAATCAGGAGGACGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1147s1c1
Sequence:CCGGCCTACTACTTCTCAGCCTTCTCTCGAGAGAAGGCTGAGAAGTAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001992.x-2152s1c1
Sequence:CCGGGACGGCAAGGTTTAAGTTATTCTCGAGAATAACTTAAACCTTGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-463s1c1
Sequence:CCGGCCCGGTCATTTCTTCTCAGGACTCGAGTCCTGAGAAGAAATGACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1349s1c1
Sequence:CCGGGCATTACTCATTCCTTTCTCACTCGAGTGAGAAAGGAATGAGTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001992
F2R MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1247s21c1
Sequence:CCGGCCCACAAACGTCCTCCTGATTCTCGAGAATCAGGAGGACGTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1270s21c1
Sequence:CCGGGCATTACTCATTCCTTTCTCACTCGAGTGAGAAAGGAATGAGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-384s21c1
Sequence:CCGGCCCGGTCATTTCTTCTCAGGACTCGAGTCCTGAGAAGAAATGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001992.3-1068s21c1
Sequence:CCGGCCTACTACTTCTCAGCCTTCTCTCGAGAGAAGGCTGAGAAGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1326s1c1
Sequence:CCGGCCCACAAACGTCCTCCTGATTCTCGAGAATCAGGAGGACGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1147s1c1
Sequence:CCGGCCTACTACTTCTCAGCCTTCTCTCGAGAGAAGGCTGAGAAGTAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001992.x-2152s1c1
Sequence:CCGGGACGGCAAGGTTTAAGTTATTCTCGAGAATAACTTAAACCTTGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-463s1c1
Sequence:CCGGCCCGGTCATTTCTTCTCAGGACTCGAGTCCTGAGAAGAAATGACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001992.x-1349s1c1
Sequence:CCGGGCATTACTCATTCCTTTCTCACTCGAGTGAGAAAGGAATGAGTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010169
F2R MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-397s21c1
Sequence:GTACCGGTGTACACGATTGTGTTCATTGCTCGAGCAATGAACACAATCGTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010169.3-1522s21c1
Sequence:CCGGAGGTGACGGGAACGGAAATAACTCGAGTTATTTCCGTTCCCGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-1314s21c1
Sequence:CCGGCACCTGAATAACAGCATATACCTCGAGGTATATGCTGTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-1166s21c1
Sequence:CCGGCTGCATCGATCCGTTGATTTACTCGAGTAAATCAACGGATCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-643s21c1
Sequence:CCGGTCATGCTCATGACGGTCATAACTCGAGTTATGACCGTCATGAGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1303s1c1
Sequence:CCGGCCTGCTCTAGTCACCTGAATACTCGAGTATTCAGGTGACTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-282s1c1
Sequence:CCGGAGGGCAGTCTACTTAAATATACTCGAGTATATTTAAGTAGACTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1172s1c1
Sequence:CCGGCGATCCGTTGATTTACTACTACTCGAGTAGTAGTAAATCAACGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1316s1c1
Sequence:CCGGCCTGAATAACAGCATATACAACTCGAGTTGTATATGCTGTTATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-731s1c1
Sequence:CCGGCAACTTCACTTGCGTGGTCATCTCGAGATGACCACGCAAGTGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010169
F2R MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-397s21c1
Sequence:GTACCGGTGTACACGATTGTGTTCATTGCTCGAGCAATGAACACAATCGTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010169.3-1522s21c1
Sequence:CCGGAGGTGACGGGAACGGAAATAACTCGAGTTATTTCCGTTCCCGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-1314s21c1
Sequence:CCGGCACCTGAATAACAGCATATACCTCGAGGTATATGCTGTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-1166s21c1
Sequence:CCGGCTGCATCGATCCGTTGATTTACTCGAGTAAATCAACGGATCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-643s21c1
Sequence:CCGGTCATGCTCATGACGGTCATAACTCGAGTTATGACCGTCATGAGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1303s1c1
Sequence:CCGGCCTGCTCTAGTCACCTGAATACTCGAGTATTCAGGTGACTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-282s1c1
Sequence:CCGGAGGGCAGTCTACTTAAATATACTCGAGTATATTTAAGTAGACTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1172s1c1
Sequence:CCGGCGATCCGTTGATTTACTACTACTCGAGTAGTAGTAAATCAACGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1316s1c1
Sequence:CCGGCCTGAATAACAGCATATACAACTCGAGTTGTATATGCTGTTATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-731s1c1
Sequence:CCGGCAACTTCACTTGCGTGGTCATCTCGAGATGACCACGCAAGTGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010169
F2R MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-397s21c1
Sequence:GTACCGGTGTACACGATTGTGTTCATTGCTCGAGCAATGAACACAATCGTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010169.3-1522s21c1
Sequence:CCGGAGGTGACGGGAACGGAAATAACTCGAGTTATTTCCGTTCCCGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-1314s21c1
Sequence:CCGGCACCTGAATAACAGCATATACCTCGAGGTATATGCTGTTATTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-1166s21c1
Sequence:CCGGCTGCATCGATCCGTTGATTTACTCGAGTAAATCAACGGATCGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010169.3-643s21c1
Sequence:CCGGTCATGCTCATGACGGTCATAACTCGAGTTATGACCGTCATGAGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1303s1c1
Sequence:CCGGCCTGCTCTAGTCACCTGAATACTCGAGTATTCAGGTGACTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-282s1c1
Sequence:CCGGAGGGCAGTCTACTTAAATATACTCGAGTATATTTAAGTAGACTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1172s1c1
Sequence:CCGGCGATCCGTTGATTTACTACTACTCGAGTAGTAGTAAATCAACGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-1316s1c1
Sequence:CCGGCCTGAATAACAGCATATACAACTCGAGTTGTATATGCTGTTATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010169.2-731s1c1
Sequence:CCGGCAACTTCACTTGCGTGGTCATCTCGAGATGACCACGCAAGTGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks