EMAIL THIS PAGE TO A FRIEND

F2RL1

coagulation factor II (thrombin) receptor-like 1

61 Gene Product Result for
Synonyms: GPR11 PAR2
UniProtKB ID: P55085, Q13317, Q13346, Q53XJ8
Gene ID:
Human(2150) Summary: Coagulation factor II (thrombin) receptor-like 1 (F2RL1) is a member of the large family of 7-transmembrane-region receptors that couple to guanosine-nucleotide-binding proteins. F2RL1 is also a member of the protease-activated receptor family. It is activated by trypsin, but not by thrombin. It is activated by proteolytic cleavage of its extracellular amino terminus. The new amino terminus functions as a tethered ligand and activates the receptor. The F2RL1 gene contains two exons and is widely expressed in human tissues. The predicted protein sequence is 83% identical to the mouse receptor sequence. [provided by RefSeq, Jul 2008]
Mouse(14063) coagulation factor II (thrombin) receptor-like 1
Rat(116677) coagulation factor II (thrombin) receptor-like 1
sheep(101106266) coagulation factor II (thrombin) receptor-like 1
domestic guinea pig(100719602) coagulation factor II (thrombin) receptor-like 1
naked mole-rat(101708898) coagulation factor II (thrombin) receptor-like 1
chicken(427213) coagulation factor II (thrombin) receptor-like 1
dog(488940) coagulation factor II (thrombin) receptor-like 1
domestic cat(101082879) coagulation factor II (thrombin) receptor-like 1
cow(526525) coagulation factor II (thrombin) receptor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005242 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005242 Rosetta Predictions human pricing
NM_053897 Rosetta Predictions rat pricing
NM_007974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339249 predicted 774
2 SASI_Hs01_00176870 predicted 385
3 SASI_Hs01_00176871 predicted 737
4 SASI_Hs01_00176872 predicted 1379
5 SASI_Hs01_00176873 predicted 712
6 SASI_Hs01_00176874 predicted 1415
7 SASI_Hs01_00176875 predicted 256
8 SASI_Hs01_00176877 predicted 1256
9 SASI_Hs01_00176878 predicted 857
10 SASI_Hs01_00176879 predicted 1111
11 SASI_Hs01_00176876 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101993 predicted 596
2 SASI_Rn01_00101994 predicted 322
3 SASI_Rn01_00101995 predicted 483
4 SASI_Rn01_00101996 predicted 1706
5 SASI_Rn01_00101997 predicted 967
6 SASI_Rn01_00101998 predicted 1689
7 SASI_Rn01_00101999 predicted 329
8 SASI_Rn01_00102000 predicted 666
9 SASI_Rn02_00266819 predicted 411
10 SASI_Rn02_00266820 predicted 903
11 SASI_Rn01_00101991 predicted 325
12 SASI_Rn01_00101992 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312870 predicted 1083
2 SASI_Mm01_00079075 predicted 446
3 SASI_Mm02_00312871 predicted 197
4 SASI_Mm01_00079079 predicted 968
5 SASI_Mm02_00312872 predicted 1072
6 SASI_Mm02_00312873 predicted 212
7 SASI_Mm02_00312874 predicted 789
8 SASI_Mm02_00312875 predicted 336
9 SASI_Mm01_00079080 predicted 353
10 SASI_Mm01_00079081 predicted 372
11 SASI_Mm01_00079076 predicted 922
12 SASI_Mm01_00079077 predicted 860
13 SASI_Mm01_00079078 predicted 915
14 SASI_Mm01_00079082 predicted 372
15 SASI_Mm01_00079083 predicted 331
16 SASI_Mm01_00079084 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007974
F2RL1 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1255s1c1
Sequence:CCGGGCTCCTACTCTTCAAGCTCAACTCGAGTTGAGCTTGAAGAGTAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1025s1c1
Sequence:CCGGCGTAGTGCATTATTTCCTAATCTCGAGATTAGGAAATAATGCACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1198s1c1
Sequence:CCGGGCACTGTGAATCGCATGCAAACTCGAGTTTGCATGCGATTCACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-513s1c1
Sequence:CCGGCATGGCAACAACTGGGTCTATCTCGAGATAGACCCAGTTGTTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007974.2-2279s1c1
Sequence:CCGGGCCAACTACAAATACTGCTTACTCGAGTAAGCAGTATTTGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007974
F2RL1 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1255s1c1
Sequence:CCGGGCTCCTACTCTTCAAGCTCAACTCGAGTTGAGCTTGAAGAGTAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1025s1c1
Sequence:CCGGCGTAGTGCATTATTTCCTAATCTCGAGATTAGGAAATAATGCACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1198s1c1
Sequence:CCGGGCACTGTGAATCGCATGCAAACTCGAGTTTGCATGCGATTCACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-513s1c1
Sequence:CCGGCATGGCAACAACTGGGTCTATCTCGAGATAGACCCAGTTGTTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007974.2-2279s1c1
Sequence:CCGGGCCAACTACAAATACTGCTTACTCGAGTAAGCAGTATTTGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007974
F2RL1 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1255s1c1
Sequence:CCGGGCTCCTACTCTTCAAGCTCAACTCGAGTTGAGCTTGAAGAGTAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1025s1c1
Sequence:CCGGCGTAGTGCATTATTTCCTAATCTCGAGATTAGGAAATAATGCACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-1198s1c1
Sequence:CCGGGCACTGTGAATCGCATGCAAACTCGAGTTTGCATGCGATTCACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007974.2-513s1c1
Sequence:CCGGCATGGCAACAACTGGGTCTATCTCGAGATAGACCCAGTTGTTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007974.2-2279s1c1
Sequence:CCGGGCCAACTACAAATACTGCTTACTCGAGTAAGCAGTATTTGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005242
VALIDATED
F2RL1 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-2010s1c1
Sequence:CCGGCGAAACCTCATCTCTACTAAACTCGAGTTTAGTAGAGATGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-590s1c1
Sequence:CCGGGCTCTTTGTAATGTGCTTATTCTCGAGAATAAGCACATTACAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005242.3-249s1c1
Sequence:CCGGCCTCTAAAGGAAGAAGCCTTACTCGAGTAAGGCTTCTTCCTTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005242.3-482s1c1
Sequence:CCGGGCTGTGATTTACATGGCCAATCTCGAGATTGGCCATGTAAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-1326s1c1
Sequence:CCGGCCACTGTTAAGACCTCCTATTCTCGAGAATAGGAGGTCTTAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1258s21c1
Sequence:CCGGCCGAAGTGTCCGCACTGTAAACTCGAGTTTACAGTGCGGACACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-564s21c1
Sequence:CCGGTGAAGATTGCCTATCACATACCTCGAGGTATGTGATAGGCAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1163s21c1
Sequence:CCGGCTCTGCCTCTCTACCCTTAACCTCGAGGTTAAGGGTAGAGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1090s21c1
Sequence:CCGGTCTGCTTGTGGTGCATTATTTCTCGAGAAATAATGCACCACAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005242.4-1401s21c1
Sequence:CCGGGTAGGATGTGGAACCTGTTTACTCGAGTAAACAGGTTCCACATCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005242
VALIDATED
F2RL1 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-2010s1c1
Sequence:CCGGCGAAACCTCATCTCTACTAAACTCGAGTTTAGTAGAGATGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-590s1c1
Sequence:CCGGGCTCTTTGTAATGTGCTTATTCTCGAGAATAAGCACATTACAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005242.3-249s1c1
Sequence:CCGGCCTCTAAAGGAAGAAGCCTTACTCGAGTAAGGCTTCTTCCTTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005242.3-482s1c1
Sequence:CCGGGCTGTGATTTACATGGCCAATCTCGAGATTGGCCATGTAAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-1326s1c1
Sequence:CCGGCCACTGTTAAGACCTCCTATTCTCGAGAATAGGAGGTCTTAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1258s21c1
Sequence:CCGGCCGAAGTGTCCGCACTGTAAACTCGAGTTTACAGTGCGGACACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-564s21c1
Sequence:CCGGTGAAGATTGCCTATCACATACCTCGAGGTATGTGATAGGCAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1163s21c1
Sequence:CCGGCTCTGCCTCTCTACCCTTAACCTCGAGGTTAAGGGTAGAGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1090s21c1
Sequence:CCGGTCTGCTTGTGGTGCATTATTTCTCGAGAAATAATGCACCACAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005242.4-1401s21c1
Sequence:CCGGGTAGGATGTGGAACCTGTTTACTCGAGTAAACAGGTTCCACATCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005242
VALIDATED
F2RL1 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-2010s1c1
Sequence:CCGGCGAAACCTCATCTCTACTAAACTCGAGTTTAGTAGAGATGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-590s1c1
Sequence:CCGGGCTCTTTGTAATGTGCTTATTCTCGAGAATAAGCACATTACAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005242.3-249s1c1
Sequence:CCGGCCTCTAAAGGAAGAAGCCTTACTCGAGTAAGGCTTCTTCCTTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005242.3-482s1c1
Sequence:CCGGGCTGTGATTTACATGGCCAATCTCGAGATTGGCCATGTAAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005242.3-1326s1c1
Sequence:CCGGCCACTGTTAAGACCTCCTATTCTCGAGAATAGGAGGTCTTAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1258s21c1
Sequence:CCGGCCGAAGTGTCCGCACTGTAAACTCGAGTTTACAGTGCGGACACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-564s21c1
Sequence:CCGGTGAAGATTGCCTATCACATACCTCGAGGTATGTGATAGGCAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1163s21c1
Sequence:CCGGCTCTGCCTCTCTACCCTTAACCTCGAGGTTAAGGGTAGAGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005242.4-1090s21c1
Sequence:CCGGTCTGCTTGTGGTGCATTATTTCTCGAGAAATAATGCACCACAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005242.4-1401s21c1
Sequence:CCGGGTAGGATGTGGAACCTGTTTACTCGAGTAAACAGGTTCCACATCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks