EMAIL THIS PAGE TO A FRIEND

F2RL2

coagulation factor II (thrombin) receptor-like 2

60 Gene Product Result for
Synonyms: PAR-3 PAR3
UniProtKB ID: O00254, B2R754, B4DQ13, Q52M68, Q7Z3W3
Gene ID:
Human(2151) Summary: This gene encodes a member of the protease-activated receptor (PAR) family which is a subfamily of the seven transmembrane G protein-coupled cell surface receptor family. The encoded protein acts as a cofactor in the thrombin-mediated cleavage and activation of the protease-activated receptor family member PAR4. The encoded protein plays an essential role in hemostasis and thrombosis. Alternate splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Feb 2012]
Mouse(14064) coagulation factor II (thrombin) receptor-like 2
Rat(29636) coagulation factor II (thrombin) receptor-like 2
Zebrafish(100148468) coagulation factor II (thrombin) receptor-like 2
cow(512581) coagulation factor II (thrombin) receptor-like 2
domestic cat(101100615) coagulation factor II (thrombin) receptor-like 2
dog(607963) coagulation factor II (thrombin) receptor-like 2
chicken(768449) coagulation factor II (thrombin) receptor-like 2
sheep(101110677) coagulation factor II (thrombin) receptor-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004101 Rosetta Predictions human pricing
NM_053313 Rosetta Predictions rat pricing
NM_010170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063343 predicted 628
2 SASI_Hs01_00063344 predicted 1169
3 SASI_Hs01_00063345 predicted 1052
4 SASI_Hs02_00336914 predicted 1035
5 SASI_Hs01_00063346 predicted 476
6 SASI_Hs01_00063348 predicted 610
7 SASI_Hs02_00336915 predicted 452
8 SASI_Hs01_00063350 predicted 1039
9 SASI_Hs02_00336916 predicted 1144
10 SASI_Hs01_00063352 predicted 1218
11 SASI_Hs01_00063347 predicted 1127
12 SASI_Hs01_00063349 predicted 1215
13 SASI_Hs01_00063351 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075660 predicted 318
2 SASI_Rn01_00075661 predicted 269
3 SASI_Rn01_00075663 predicted 494
4 SASI_Rn01_00075664 predicted 563
5 SASI_Rn01_00075665 predicted 934
6 SASI_Rn01_00075666 predicted 261
7 SASI_Rn01_00075667 predicted 363
8 SASI_Rn01_00075668 predicted 672
9 SASI_Rn01_00075669 predicted 906
10 SASI_Rn02_00265734 predicted 929
11 SASI_Rn01_00075662 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317936 predicted 201
2 SASI_Mm01_00129036 predicted 899
3 SASI_Mm02_00317937 predicted 201
4 SASI_Mm01_00129038 predicted 1019
5 SASI_Mm01_00129039 predicted 404
6 SASI_Mm02_00317938 predicted 404
7 SASI_Mm01_00129040 predicted 448
8 SASI_Mm02_00317939 predicted 1012
9 SASI_Mm02_00317940 predicted 199
10 SASI_Mm01_00129041 predicted 417
11 SASI_Mm01_00129035 predicted 340
12 SASI_Mm01_00129037 predicted 957
13 SASI_Mm01_00129042 predicted 1054
14 SASI_Mm01_00129043 predicted 327
15 SASI_Mm01_00129044 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004101
F2RL2 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-624s21c1
Sequence:CCGGCCCTTTAAGATAGCTTATCATCTCGAGATGATAAGCTATCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-408s21c1
Sequence:CCGGGCTTCACATCTCCATGTGAAACTCGAGTTTCACATGGAGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-1044s21c1
Sequence:CCGGCGGACACTTAATGCATACGATCTCGAGATCGTATGCATTAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-1219s21c1
Sequence:CCGGGCCTGGGTAGTCTTAATAGTTCTCGAGAACTATTAAGACTACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004101.2-2935s1c1
Sequence:CCGGCCCATTAACTTCGTACTGAAACTCGAGTTTCAGTACGAAGTTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-408s1c1
Sequence:CCGGGCTTCACATCTCCATGTGAAACTCGAGTTTCACATGGAGATGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-624s1c1
Sequence:CCGGCCCTTTAAGATAGCTTATCATCTCGAGATGATAAGCTATCTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-1219s1c1
Sequence:CCGGGCCTGGGTAGTCTTAATAGTTCTCGAGAACTATTAAGACTACCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-1044s1c1
Sequence:CCGGCGGACACTTAATGCATACGATCTCGAGATCGTATGCATTAAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004101
F2RL2 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-624s21c1
Sequence:CCGGCCCTTTAAGATAGCTTATCATCTCGAGATGATAAGCTATCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-408s21c1
Sequence:CCGGGCTTCACATCTCCATGTGAAACTCGAGTTTCACATGGAGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-1044s21c1
Sequence:CCGGCGGACACTTAATGCATACGATCTCGAGATCGTATGCATTAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-1219s21c1
Sequence:CCGGGCCTGGGTAGTCTTAATAGTTCTCGAGAACTATTAAGACTACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004101.2-2935s1c1
Sequence:CCGGCCCATTAACTTCGTACTGAAACTCGAGTTTCAGTACGAAGTTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-408s1c1
Sequence:CCGGGCTTCACATCTCCATGTGAAACTCGAGTTTCACATGGAGATGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-624s1c1
Sequence:CCGGCCCTTTAAGATAGCTTATCATCTCGAGATGATAAGCTATCTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-1219s1c1
Sequence:CCGGGCCTGGGTAGTCTTAATAGTTCTCGAGAACTATTAAGACTACCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-1044s1c1
Sequence:CCGGCGGACACTTAATGCATACGATCTCGAGATCGTATGCATTAAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004101
F2RL2 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-624s21c1
Sequence:CCGGCCCTTTAAGATAGCTTATCATCTCGAGATGATAAGCTATCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-408s21c1
Sequence:CCGGGCTTCACATCTCCATGTGAAACTCGAGTTTCACATGGAGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-1044s21c1
Sequence:CCGGCGGACACTTAATGCATACGATCTCGAGATCGTATGCATTAAGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004101.2-1219s21c1
Sequence:CCGGGCCTGGGTAGTCTTAATAGTTCTCGAGAACTATTAAGACTACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004101.2-2935s1c1
Sequence:CCGGCCCATTAACTTCGTACTGAAACTCGAGTTTCAGTACGAAGTTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-408s1c1
Sequence:CCGGGCTTCACATCTCCATGTGAAACTCGAGTTTCACATGGAGATGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-624s1c1
Sequence:CCGGCCCTTTAAGATAGCTTATCATCTCGAGATGATAAGCTATCTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-1219s1c1
Sequence:CCGGGCCTGGGTAGTCTTAATAGTTCTCGAGAACTATTAAGACTACCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004101.2-1044s1c1
Sequence:CCGGCGGACACTTAATGCATACGATCTCGAGATCGTATGCATTAAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010170
F2RL2 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1161s1c1
Sequence:CCGGCCTAGATCCATTCCTTTACTTCTCGAGAAGTAAAGGAATGGATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-356s1c1
Sequence:CCGGCCATAGGATACCTGAGAAGTTCTCGAGAACTTCTCAGGTATCCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1051s1c1
Sequence:CCGGCCCACCAACATCATACTCGTACTCGAGTACGAGTATGATGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1081s1c1
Sequence:CCGGGCCAACTACTACTACCACAATCTCGAGATTGTGGTAGTAGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-867s1c1
Sequence:CCGGCCCATCATCCTTCCGATTCTACTCGAGTAGAATCGGAAGGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010170
F2RL2 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1161s1c1
Sequence:CCGGCCTAGATCCATTCCTTTACTTCTCGAGAAGTAAAGGAATGGATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-356s1c1
Sequence:CCGGCCATAGGATACCTGAGAAGTTCTCGAGAACTTCTCAGGTATCCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1051s1c1
Sequence:CCGGCCCACCAACATCATACTCGTACTCGAGTACGAGTATGATGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1081s1c1
Sequence:CCGGGCCAACTACTACTACCACAATCTCGAGATTGTGGTAGTAGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-867s1c1
Sequence:CCGGCCCATCATCCTTCCGATTCTACTCGAGTAGAATCGGAAGGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010170
F2RL2 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1161s1c1
Sequence:CCGGCCTAGATCCATTCCTTTACTTCTCGAGAAGTAAAGGAATGGATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-356s1c1
Sequence:CCGGCCATAGGATACCTGAGAAGTTCTCGAGAACTTCTCAGGTATCCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1051s1c1
Sequence:CCGGCCCACCAACATCATACTCGTACTCGAGTACGAGTATGATGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-1081s1c1
Sequence:CCGGGCCAACTACTACTACCACAATCTCGAGATTGTGGTAGTAGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010170.2-867s1c1
Sequence:CCGGCCCATCATCCTTCCGATTCTACTCGAGTAGAATCGGAAGGATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks