EMAIL THIS PAGE TO A FRIEND

F2RL3

coagulation factor II (thrombin) receptor-like 3

52 Gene Product Result for
Synonyms: PAR4
UniProtKB ID: Q96RI0, O76067, Q6DK42
Gene ID:
Human(9002) Summary: Coagulation factor II (thrombin) receptor-like 3 (F2RL3) is a member of the large family of 7-transmembrane-region receptors that couple to guanosine-nucleotide-binding proteins. F2RL3 is also a member of the protease-activated receptor family. F2RL3 is activated by proteolytic cleavage of its extracellular amino terminus. The new amino terminus functions as a tethered ligand and activates the receptor. F2RL3 is activated by thrombin and trypsin. [provided by RefSeq, Jul 2008]
Mouse(14065) coagulation factor II (thrombin) receptor-like 3
Rat(116498) coagulation factor II (thrombin) receptor-like 3
sheep(101114699) coagulation factor II (thrombin) receptor-like 3
domestic guinea pig(100730527) coagulation factor II (thrombin) receptor-like 3
naked mole-rat(101697889) coagulation factor II (thrombin) receptor-like 3
chicken(420139) coagulation factor II (thrombin) receptor-like 3
dog(484846) coagulation factor II (thrombin) receptor-like 3
cow(538963) coagulation factor II (thrombin) receptor-like 3
domestic cat(101081027) coagulation factor II (thrombin) receptor-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003950 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151081 MISSION® esiRNA esiRNA human F2RL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003950 Rosetta Predictions human pricing
NM_053808 Rosetta Predictions rat pricing
NM_007975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162726 predicted 635
2 SASI_Hs01_00162727 predicted 323
3 SASI_Hs01_00162728 predicted 497
4 SASI_Hs01_00162729 predicted 411
5 SASI_Hs01_00162730 predicted 1113
6 SASI_Hs01_00162731 predicted 328
7 SASI_Hs01_00162732 predicted 747
8 SASI_Hs01_00162733 predicted 635
9 SASI_Hs01_00162735 predicted 900
10 SASI_Hs02_00336615 predicted 753
11 SASI_Hs01_00162734 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044309 predicted 1236
2 SASI_Rn02_00266633 predicted 234
3 SASI_Rn01_00044310 predicted 331
4 SASI_Rn01_00044311 predicted 1005
5 SASI_Rn01_00044312 predicted 283
6 SASI_Rn01_00044313 predicted 617
7 SASI_Rn01_00044314 predicted 820
8 SASI_Rn01_00044316 predicted 986
9 SASI_Rn01_00044317 predicted 241
10 SASI_Rn02_00266634 predicted 877
11 SASI_Rn01_00044308 predicted 1368
12 SASI_Rn01_00044315 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134340 predicted 523
2 SASI_Mm01_00134341 predicted 1294
3 SASI_Mm01_00134343 predicted 1535
4 SASI_Mm01_00134344 predicted 1539
5 SASI_Mm02_00312876 predicted 1296
6 SASI_Mm01_00134345 predicted 1441
7 SASI_Mm01_00134346 predicted 1502
8 SASI_Mm01_00134347 predicted 709
9 SASI_Mm01_00134348 predicted 1493
10 SASI_Mm02_00312877 predicted 1538
11 SASI_Mm01_00134342 predicted 1196
12 SASI_Mm01_00134349 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007975
F2RL3 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor-like 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007975.2-1262s1c1
Sequence:CCGGCCCTTAAACTACATCCCTCTTCTCGAGAAGAGGGATGTAGTTTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-101s1c1
Sequence:CCGGTCTACGATGATGTAGAGAGTACTCGAGTACTCTCTACATCATCGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-633s1c1
Sequence:CCGGCCTCACTACTGGACTCTGTTTCTCGAGAAACAGAGTCCAGTAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-212s1c1
Sequence:CCGGGCAAATTCTGTGCCAACGACACTCGAGTGTCGTTGGCACAGAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-699s1c1
Sequence:CCGGGCATCGGCAGACCTTCCGATTCTCGAGAATCGGAAGGTCTGCCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1502s21c1
Sequence:CCGGAGTTATGAGGTCACTAGCTAGCTCGAGCTAGCTAGTGACCTCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1338s21c1
Sequence:CCGGGAGCTGAGGTCCACTGGAAATCTCGAGATTTCCAGTGGACCTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1287s21c1
Sequence:CCGGCTCAGGACATGACCTTATTTGCTCGAGCAAATAAGGTCATGTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007975
F2RL3 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor-like 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007975.2-1262s1c1
Sequence:CCGGCCCTTAAACTACATCCCTCTTCTCGAGAAGAGGGATGTAGTTTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-101s1c1
Sequence:CCGGTCTACGATGATGTAGAGAGTACTCGAGTACTCTCTACATCATCGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-633s1c1
Sequence:CCGGCCTCACTACTGGACTCTGTTTCTCGAGAAACAGAGTCCAGTAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-212s1c1
Sequence:CCGGGCAAATTCTGTGCCAACGACACTCGAGTGTCGTTGGCACAGAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-699s1c1
Sequence:CCGGGCATCGGCAGACCTTCCGATTCTCGAGAATCGGAAGGTCTGCCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1502s21c1
Sequence:CCGGAGTTATGAGGTCACTAGCTAGCTCGAGCTAGCTAGTGACCTCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1338s21c1
Sequence:CCGGGAGCTGAGGTCCACTGGAAATCTCGAGATTTCCAGTGGACCTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1287s21c1
Sequence:CCGGCTCAGGACATGACCTTATTTGCTCGAGCAAATAAGGTCATGTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007975
F2RL3 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor-like 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007975.2-1262s1c1
Sequence:CCGGCCCTTAAACTACATCCCTCTTCTCGAGAAGAGGGATGTAGTTTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-101s1c1
Sequence:CCGGTCTACGATGATGTAGAGAGTACTCGAGTACTCTCTACATCATCGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-633s1c1
Sequence:CCGGCCTCACTACTGGACTCTGTTTCTCGAGAAACAGAGTCCAGTAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-212s1c1
Sequence:CCGGGCAAATTCTGTGCCAACGACACTCGAGTGTCGTTGGCACAGAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007975.2-699s1c1
Sequence:CCGGGCATCGGCAGACCTTCCGATTCTCGAGAATCGGAAGGTCTGCCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1502s21c1
Sequence:CCGGAGTTATGAGGTCACTAGCTAGCTCGAGCTAGCTAGTGACCTCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1338s21c1
Sequence:CCGGGAGCTGAGGTCCACTGGAAATCTCGAGATTTCCAGTGGACCTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007975.3-1287s21c1
Sequence:CCGGCTCAGGACATGACCTTATTTGCTCGAGCAAATAAGGTCATGTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003950
F2RL3 MISSION shRNA Bacterial Glycerol Stock
coagulation factor II (thrombin) receptor-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-916s1c1
Sequence:CCGGCCTGGCGCTGTTGGGCTGTTTCTCGAGAAACAGCCCAACAGCGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-322s1c1
Sequence:CCGGCCCAGGCCAAGTCTGTGCCAACTCGAGTTGGCACAGACTTGGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003950.1-2764s1c1
Sequence:CCGGCCCAGGAATCTGAAACAGGATCTCGAGATCCTGTTTCAGATTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-1185s1c1
Sequence:CCGGCCTTCATCTACTACTACGTGTCTCGAGACACGTAGTAGTAGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-638s1c1
Sequence:CCGGGCACTCTATGGTCACATGTATCTCGAGATACATGTGACCATAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003950.2-1493s21c1
Sequence:CCGGGGTGGTGTCCTCATAAGATAACTCGAGTTATCTTATGAGGACACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003950.2-639s21c1
Sequence:CCGGCACTCTATGGTCACATGTATGCTCGAGCATACATGTGACCATAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003950.2-1444s21c1
Sequence:CCGGTCACTAGCGGAGGTCACTTTGCTCGAGCAAAGTGACCTCCGCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003950.2-1178s21c1
Sequence:CCGGGTGGATCCCTTCATCTACTACCTCGAGGTAGTAGATGAAGGGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003950
F2RL3 MISSION shRNA shRNA Plasmid DNA
coagulation factor II (thrombin) receptor-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-916s1c1
Sequence:CCGGCCTGGCGCTGTTGGGCTGTTTCTCGAGAAACAGCCCAACAGCGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-322s1c1
Sequence:CCGGCCCAGGCCAAGTCTGTGCCAACTCGAGTTGGCACAGACTTGGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003950.1-2764s1c1
Sequence:CCGGCCCAGGAATCTGAAACAGGATCTCGAGATCCTGTTTCAGATTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-1185s1c1
Sequence:CCGGCCTTCATCTACTACTACGTGTCTCGAGACACGTAGTAGTAGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-638s1c1
Sequence:CCGGGCACTCTATGGTCACATGTATCTCGAGATACATGTGACCATAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003950.2-1493s21c1
Sequence:CCGGGGTGGTGTCCTCATAAGATAACTCGAGTTATCTTATGAGGACACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003950.2-639s21c1
Sequence:CCGGCACTCTATGGTCACATGTATGCTCGAGCATACATGTGACCATAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003950.2-1444s21c1
Sequence:CCGGTCACTAGCGGAGGTCACTTTGCTCGAGCAAAGTGACCTCCGCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003950.2-1178s21c1
Sequence:CCGGGTGGATCCCTTCATCTACTACCTCGAGGTAGTAGATGAAGGGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003950
F2RL3 MISSION shRNA Lentiviral Transduction Particles
coagulation factor II (thrombin) receptor-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-916s1c1
Sequence:CCGGCCTGGCGCTGTTGGGCTGTTTCTCGAGAAACAGCCCAACAGCGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-322s1c1
Sequence:CCGGCCCAGGCCAAGTCTGTGCCAACTCGAGTTGGCACAGACTTGGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003950.1-2764s1c1
Sequence:CCGGCCCAGGAATCTGAAACAGGATCTCGAGATCCTGTTTCAGATTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-1185s1c1
Sequence:CCGGCCTTCATCTACTACTACGTGTCTCGAGACACGTAGTAGTAGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003950.1-638s1c1
Sequence:CCGGGCACTCTATGGTCACATGTATCTCGAGATACATGTGACCATAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003950.2-1493s21c1
Sequence:CCGGGGTGGTGTCCTCATAAGATAACTCGAGTTATCTTATGAGGACACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003950.2-639s21c1
Sequence:CCGGCACTCTATGGTCACATGTATGCTCGAGCATACATGTGACCATAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003950.2-1444s21c1
Sequence:CCGGTCACTAGCGGAGGTCACTTTGCTCGAGCAAAGTGACCTCCGCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003950.2-1178s21c1
Sequence:CCGGGTGGATCCCTTCATCTACTACCTCGAGGTAGTAGATGAAGGGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks