EMAIL THIS PAGE TO A FRIEND

F3

coagulation factor III (thromboplastin, tissue factor)

68 Gene Product Result for
Synonyms: CD142 TF TFA
UniProtKB ID: P13726, D3DT47, Q6FHG2, Q86WH4
Gene ID:
Human(2152) Summary: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(14066) coagulation factor III
Rat(25584) coagulation factor III (thromboplastin, tissue factor)
chicken(429084) coagulation factor III (thromboplastin, tissue factor)
cow(280686) coagulation factor III
domestic cat(101082330) coagulation factor III (thromboplastin, tissue factor)
dog(490153) coagulation factor III (thromboplastin, tissue factor)
naked mole-rat(101702267) coagulation factor III (thromboplastin, tissue factor)
domestic guinea pig(100135463) coagulation factor III
sheep(101118918) coagulation factor III (thromboplastin, tissue factor)
Domestic Rabbit(100009127) coagulation factor III (thromboplastin, tissue factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405779 Anti-F3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB1410355 Anti-F3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
HPA049292 Anti-F3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA069132 Anti-F3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4504151 Anti-phospho-Coagulation Factor III (pSer290) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0002152M1 Monoclonal Anti-F3 antibody produced in mouse clone 4G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403798 Monoclonal Anti-F3 antibody produced in mouse clone 4G4, ascites fluid human
ELISA, western blot pricing
AMAB91235 Monoclonal Anti-F3 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3805, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91236 Monoclonal Anti-F3 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3807, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076311 MISSION® esiRNA esiRNA human F3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001993 siRNAs that have been validated in the lab human pricing
NM_013057 Rosetta Predictions rat pricing
NM_010171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001993 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235699 validated 665
2 SASI_Hs01_00235697 predicted 582
3 SASI_Hs02_00332981 predicted 837
4 SASI_Hs01_00235700 predicted 300
5 SASI_Hs01_00235702 predicted 745
6 SASI_Hs01_00235703 predicted 596
7 SASI_Hs01_00235704 predicted 310
8 SASI_Hs01_00235705 predicted 1027
9 SASI_Hs02_00332982 predicted 1016
10 SASI_Hs01_00235706 predicted 1090
11 SASI_Hs01_00235698 predicted 919
12 SASI_Hs01_00235701 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048349 predicted 261
2 SASI_Rn01_00048350 predicted 264
3 SASI_Rn01_00048351 predicted 630
4 SASI_Rn01_00048352 predicted 517
5 SASI_Rn01_00048353 predicted 785
6 SASI_Rn01_00048354 predicted 472
7 SASI_Rn01_00048355 predicted 799
8 SASI_Rn01_00048356 predicted 702
9 SASI_Rn01_00048357 predicted 282
10 SASI_Rn01_00048358 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317941 predicted 341
2 SASI_Mm02_00317942 predicted 272
3 SASI_Mm01_00168889 predicted 299
4 SASI_Mm02_00317943 predicted 358
5 SASI_Mm02_00317944 predicted 584
6 SASI_Mm01_00168888 predicted 367
7 SASI_Mm02_00317945 predicted 768
8 SASI_Mm02_00317946 predicted 492
9 SASI_Mm02_00317947 predicted 770
10 SASI_Mm02_00317948 predicted 607
11 SASI_Mm01_00168885 predicted 342
12 SASI_Mm01_00168886 predicted 341
13 SASI_Mm01_00168887 predicted 602
14 SASI_Mm01_00168890 predicted 1360
15 SASI_Mm01_00168891 predicted 1289
16 SASI_Mm01_00168892 predicted 371
17 SASI_Mm01_00168893 predicted 362
18 SASI_Mm01_00168894 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001993
F3 MISSION shRNA Bacterial Glycerol Stock
coagulation factor III (thromboplastin, tissue factor)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001993.3-1084s21c1
Sequence:CCGGGCTACTGCAAATGCTATATTGCTCGAGCAATATAGCATTTGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001993.3-1234s21c1
Sequence:CCGGACATCAGCATTAGTCACTTTGCTCGAGCAAAGTGACTAATGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001993.3-851s21c1
Sequence:CCGGGATTCCCTCCCGAACAGTTAACTCGAGTTAACTGTTCGGGAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-930s1c1
Sequence:CCGGCCTGGCTATATCTCTACACAACTCGAGTTGTGTAGAGATATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-321s1c1
Sequence:CCGGCACTGTTCAAATAAGCACTAACTCGAGTTAGTGCTTATTTGAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-598s1c1
Sequence:CCGGGTAGAAGATGAACGGACTTTACTCGAGTAAAGTCCGTTCATCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-596s1c1
Sequence:CCGGCCGTAGAAGATGAACGGACTTCTCGAGAAGTCCGTTCATCTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001993
F3 MISSION shRNA shRNA Plasmid DNA
coagulation factor III (thromboplastin, tissue factor)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001993.3-1084s21c1
Sequence:CCGGGCTACTGCAAATGCTATATTGCTCGAGCAATATAGCATTTGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001993.3-1234s21c1
Sequence:CCGGACATCAGCATTAGTCACTTTGCTCGAGCAAAGTGACTAATGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001993.3-851s21c1
Sequence:CCGGGATTCCCTCCCGAACAGTTAACTCGAGTTAACTGTTCGGGAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-930s1c1
Sequence:CCGGCCTGGCTATATCTCTACACAACTCGAGTTGTGTAGAGATATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-321s1c1
Sequence:CCGGCACTGTTCAAATAAGCACTAACTCGAGTTAGTGCTTATTTGAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-598s1c1
Sequence:CCGGGTAGAAGATGAACGGACTTTACTCGAGTAAAGTCCGTTCATCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-596s1c1
Sequence:CCGGCCGTAGAAGATGAACGGACTTCTCGAGAAGTCCGTTCATCTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001993
F3 MISSION shRNA Lentiviral Transduction Particles
coagulation factor III (thromboplastin, tissue factor)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001993.3-1084s21c1
Sequence:CCGGGCTACTGCAAATGCTATATTGCTCGAGCAATATAGCATTTGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001993.3-1234s21c1
Sequence:CCGGACATCAGCATTAGTCACTTTGCTCGAGCAAAGTGACTAATGCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001993.3-851s21c1
Sequence:CCGGGATTCCCTCCCGAACAGTTAACTCGAGTTAACTGTTCGGGAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-930s1c1
Sequence:CCGGCCTGGCTATATCTCTACACAACTCGAGTTGTGTAGAGATATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-321s1c1
Sequence:CCGGCACTGTTCAAATAAGCACTAACTCGAGTTAGTGCTTATTTGAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-598s1c1
Sequence:CCGGGTAGAAGATGAACGGACTTTACTCGAGTAAAGTCCGTTCATCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001993.2-596s1c1
Sequence:CCGGCCGTAGAAGATGAACGGACTTCTCGAGAAGTCCGTTCATCTTCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010171
VALIDATED
F3 MISSION shRNA Bacterial Glycerol Stock
coagulation factor III (thromboplastin, tissue factor)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010171.3-594s21c1
Sequence:CCGGACCTTGGACAGCCAGTAATTCCTCGAGGAATTACTGGCTGTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-716s21c1
Sequence:CCGGGGCAAGGACTTGGGTTATATACTCGAGTATATAACCCAAGTCCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-269s21c1
Sequence:CCGGATTCCAGAGAAAGCGTTTAATCTCGAGATTAAACGCTTTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010171.3-351s21c1
Sequence:CCGGATACCTACACTGTACAGATAACTCGAGTTATCTGTACAGTGTAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-1527s21c1
Sequence:CCGGGCAAGTGGCAAACTTTCATATCTCGAGATATGAAAGTTTGCCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010171.3-1211s21c1
Sequence:CCGGTTGATTCCAACACTAGCATTTCTCGAGAAATGCTAGTGTTGGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010171.2-1285s1c1
Sequence:CCGGGCACAAATGCTTTAGATTGTACTCGAGTACAATCTAAAGCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010171.2-923s1c1
Sequence:CCGGCTGGGAGAAACACTCATCATTCTCGAGAATGATGAGTGTTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-373s1c1
Sequence:CCGGCGATCGATCTAGAAACTGGAACTCGAGTTCCAGTTTCTAGATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-664s1c1
Sequence:CCGGGCTTACATTAGTCAGAAAGAACTCGAGTTCTTTCTGACTAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-661s1c1
Sequence:CCGGCTCGCTTACATTAGTCAGAAACTCGAGTTTCTGACTAATGTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010171
VALIDATED
F3 MISSION shRNA shRNA Plasmid DNA
coagulation factor III (thromboplastin, tissue factor)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010171.3-594s21c1
Sequence:CCGGACCTTGGACAGCCAGTAATTCCTCGAGGAATTACTGGCTGTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-716s21c1
Sequence:CCGGGGCAAGGACTTGGGTTATATACTCGAGTATATAACCCAAGTCCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-269s21c1
Sequence:CCGGATTCCAGAGAAAGCGTTTAATCTCGAGATTAAACGCTTTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010171.3-351s21c1
Sequence:CCGGATACCTACACTGTACAGATAACTCGAGTTATCTGTACAGTGTAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-1527s21c1
Sequence:CCGGGCAAGTGGCAAACTTTCATATCTCGAGATATGAAAGTTTGCCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010171.3-1211s21c1
Sequence:CCGGTTGATTCCAACACTAGCATTTCTCGAGAAATGCTAGTGTTGGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010171.2-1285s1c1
Sequence:CCGGGCACAAATGCTTTAGATTGTACTCGAGTACAATCTAAAGCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010171.2-923s1c1
Sequence:CCGGCTGGGAGAAACACTCATCATTCTCGAGAATGATGAGTGTTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-373s1c1
Sequence:CCGGCGATCGATCTAGAAACTGGAACTCGAGTTCCAGTTTCTAGATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-664s1c1
Sequence:CCGGGCTTACATTAGTCAGAAAGAACTCGAGTTCTTTCTGACTAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-661s1c1
Sequence:CCGGCTCGCTTACATTAGTCAGAAACTCGAGTTTCTGACTAATGTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010171
VALIDATED
F3 MISSION shRNA Lentiviral Transduction Particles
coagulation factor III (thromboplastin, tissue factor)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010171.3-594s21c1
Sequence:CCGGACCTTGGACAGCCAGTAATTCCTCGAGGAATTACTGGCTGTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-716s21c1
Sequence:CCGGGGCAAGGACTTGGGTTATATACTCGAGTATATAACCCAAGTCCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-269s21c1
Sequence:CCGGATTCCAGAGAAAGCGTTTAATCTCGAGATTAAACGCTTTCTCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010171.3-351s21c1
Sequence:CCGGATACCTACACTGTACAGATAACTCGAGTTATCTGTACAGTGTAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010171.3-1527s21c1
Sequence:CCGGGCAAGTGGCAAACTTTCATATCTCGAGATATGAAAGTTTGCCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010171.3-1211s21c1
Sequence:CCGGTTGATTCCAACACTAGCATTTCTCGAGAAATGCTAGTGTTGGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010171.2-1285s1c1
Sequence:CCGGGCACAAATGCTTTAGATTGTACTCGAGTACAATCTAAAGCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010171.2-923s1c1
Sequence:CCGGCTGGGAGAAACACTCATCATTCTCGAGAATGATGAGTGTTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-373s1c1
Sequence:CCGGCGATCGATCTAGAAACTGGAACTCGAGTTCCAGTTTCTAGATCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-664s1c1
Sequence:CCGGGCTTACATTAGTCAGAAAGAACTCGAGTTCTTTCTGACTAATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010171.2-661s1c1
Sequence:CCGGCTCGCTTACATTAGTCAGAAACTCGAGTTTCTGACTAATGTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks