EMAIL THIS PAGE TO A FRIEND

F5

coagulation factor V (proaccelerin, labile factor)

67 Gene Product Result for
Synonyms: FVL PCCF RPRGL1 THPH2
Gene ID:
Human(2153) Summary: This gene encodes an essential cofactor of the blood coagulation cascade. This factor circulates in plasma, and is converted to the active form by the release of the activation peptide by thrombin during coagulation. This generates a heavy chain and a light chain which are held together by calcium ions. The activated protein is a cofactor that participates with activated coagulation factor X to activate prothrombin to thrombin. Defects in this gene result in either an autosomal recessive hemorrhagic diathesis or an autosomal dominant form of thrombophilia, which is known as activated protein C resistance. [provided by RefSeq, Oct 2008]
Mouse(14067) coagulation factor V
Rat(304929) coagulation factor V (proaccelerin, labile factor)
Zebrafish(327320) coagulation factor V
domestic cat(101085264) coagulation factor V (proaccelerin, labile factor)
cow(280687) coagulation factor V (proaccelerin, labile factor)
Horse(100058503) coagulation factor V (proaccelerin, labile factor)
dog(100685858) coagulation factor V (proaccelerin, labile factor)
chicken(374052) coagulation factor V (proaccelerin, labile factor)
sheep(101123649) coagulation factor V (proaccelerin, labile factor)
domestic guinea pig(100715882) coagulation factor V (proaccelerin, labile factor)
naked mole-rat(101703568) coagulation factor V (proaccelerin, labile factor)
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000130 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000130 Rosetta Predictions human pricing
NM_001047878 Rosetta Predictions rat pricing
NM_007976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301935 predicted 1846
2 SASI_Hs01_00120142 predicted 5062
3 SASI_Hs01_00120143 predicted 5051
4 SASI_Hs01_00120145 predicted 453
5 SASI_Hs01_00120146 predicted 2638
6 SASI_Hs02_00301936 predicted 2348
7 SASI_Hs01_00120147 predicted 340
8 SASI_Hs01_00120149 predicted 1014
9 SASI_Hs02_00301937 predicted 6246
10 SASI_Hs02_00301938 predicted 946
11 SASI_Hs01_00120144 predicted 2299
12 SASI_Hs01_00120148 predicted 5216
13 SASI_Hs01_00120150 predicted 5913
14 SASI_Hs01_00120151 predicted 5151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206417 predicted 1108
2 SASI_Rn02_00206418 predicted 3350
3 SASI_Rn02_00206419 predicted 3345
4 SASI_Rn02_00206420 predicted 286
5 SASI_Rn02_00206421 predicted 5735
6 SASI_Rn02_00206422 predicted 4791
7 SASI_Rn02_00206423 predicted 2442
8 SASI_Rn02_00206424 predicted 1597
9 SASI_Rn02_00206425 predicted 2533
10 SASI_Rn02_00206426 predicted 5009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163236 predicted 5743
2 SASI_Mm01_00163237 predicted 1631
3 SASI_Mm01_00163238 predicted 4464
4 SASI_Mm01_00163239 predicted 5807
5 SASI_Mm01_00163240 predicted 1805
6 SASI_Mm01_00163241 predicted 935
7 SASI_Mm02_00312878 predicted 1601
8 SASI_Mm01_00163242 predicted 5083
9 SASI_Mm01_00163243 predicted 4939
10 SASI_Mm01_00163244 predicted 5028
11 SASI_Mm01_00163235 predicted 5069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007976
F5 MISSION shRNA Bacterial Glycerol Stock
coagulation factor V (proaccelerin, labile factor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-4564s1c1
Sequence:CCGGCCTCCAGAAATCCTGACACTACTCGAGTAGTGTCAGGATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-4502s1c1
Sequence:CCGGCGAGGATGACTTTGTAACCTACTCGAGTAGGTTACAAAGTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-567s1c1
Sequence:CCGGCCTCTGCTTATCTGCAAGAAACTCGAGTTTCTTGCAGATAAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-264s1c1
Sequence:CCGGCCTACTTTATACGCTGAAGTTCTCGAGAACTTCAGCGTATAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-5681s1c1
Sequence:CCGGGCCCAGATTAGCACGATTAAACTCGAGTTTAATCGTGCTAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007976
F5 MISSION shRNA shRNA Plasmid DNA
coagulation factor V (proaccelerin, labile factor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-4564s1c1
Sequence:CCGGCCTCCAGAAATCCTGACACTACTCGAGTAGTGTCAGGATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-4502s1c1
Sequence:CCGGCGAGGATGACTTTGTAACCTACTCGAGTAGGTTACAAAGTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-567s1c1
Sequence:CCGGCCTCTGCTTATCTGCAAGAAACTCGAGTTTCTTGCAGATAAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-264s1c1
Sequence:CCGGCCTACTTTATACGCTGAAGTTCTCGAGAACTTCAGCGTATAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-5681s1c1
Sequence:CCGGGCCCAGATTAGCACGATTAAACTCGAGTTTAATCGTGCTAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007976
F5 MISSION shRNA Lentiviral Transduction Particles
coagulation factor V (proaccelerin, labile factor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-4564s1c1
Sequence:CCGGCCTCCAGAAATCCTGACACTACTCGAGTAGTGTCAGGATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-4502s1c1
Sequence:CCGGCGAGGATGACTTTGTAACCTACTCGAGTAGGTTACAAAGTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-567s1c1
Sequence:CCGGCCTCTGCTTATCTGCAAGAAACTCGAGTTTCTTGCAGATAAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-264s1c1
Sequence:CCGGCCTACTTTATACGCTGAAGTTCTCGAGAACTTCAGCGTATAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007976.1-5681s1c1
Sequence:CCGGGCCCAGATTAGCACGATTAAACTCGAGTTTAATCGTGCTAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000130
F5 MISSION shRNA Bacterial Glycerol Stock
coagulation factor V (proaccelerin, labile factor)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-5502s1c1
Sequence:CCGGCCCATGAGTTTCACGCCATTACTCGAGTAATGGCGTGAAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-2125s1c1
Sequence:CCGGGCTGAAATTCAGGGATGTTAACTCGAGTTAACATCCCTGAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-531s1c1
Sequence:CCGGGCCGAGAATACACCTATGAATCTCGAGATTCATAGGTGTATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-6196s1c1
Sequence:CCGGCCCACCTATTGTGGCTAGATACTCGAGTATCTAGCCACAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-1057s1c1
Sequence:CCGGGCAGGCTTACATTGACATTAACTCGAGTTAATGTCAATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-1686s21c1
Sequence:CCGGACATCGCCTCTGGGCTAATAGCTCGAGCTATTAGCCCAGAGGCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-861s21c1
Sequence:CCGGATGGGACAATGCCAGATATAACTCGAGTTATATCTGGCATTGTCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-5880s21c1
Sequence:CCGGGACTAAGCACTGGTATCATATCTCGAGATATGATACCAGTGCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000130
F5 MISSION shRNA shRNA Plasmid DNA
coagulation factor V (proaccelerin, labile factor)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-5502s1c1
Sequence:CCGGCCCATGAGTTTCACGCCATTACTCGAGTAATGGCGTGAAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-2125s1c1
Sequence:CCGGGCTGAAATTCAGGGATGTTAACTCGAGTTAACATCCCTGAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-531s1c1
Sequence:CCGGGCCGAGAATACACCTATGAATCTCGAGATTCATAGGTGTATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-6196s1c1
Sequence:CCGGCCCACCTATTGTGGCTAGATACTCGAGTATCTAGCCACAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-1057s1c1
Sequence:CCGGGCAGGCTTACATTGACATTAACTCGAGTTAATGTCAATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-1686s21c1
Sequence:CCGGACATCGCCTCTGGGCTAATAGCTCGAGCTATTAGCCCAGAGGCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-861s21c1
Sequence:CCGGATGGGACAATGCCAGATATAACTCGAGTTATATCTGGCATTGTCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-5880s21c1
Sequence:CCGGGACTAAGCACTGGTATCATATCTCGAGATATGATACCAGTGCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000130
F5 MISSION shRNA Lentiviral Transduction Particles
coagulation factor V (proaccelerin, labile factor)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-5502s1c1
Sequence:CCGGCCCATGAGTTTCACGCCATTACTCGAGTAATGGCGTGAAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-2125s1c1
Sequence:CCGGGCTGAAATTCAGGGATGTTAACTCGAGTTAACATCCCTGAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-531s1c1
Sequence:CCGGGCCGAGAATACACCTATGAATCTCGAGATTCATAGGTGTATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-6196s1c1
Sequence:CCGGCCCACCTATTGTGGCTAGATACTCGAGTATCTAGCCACAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000130.2-1057s1c1
Sequence:CCGGGCAGGCTTACATTGACATTAACTCGAGTTAATGTCAATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-1686s21c1
Sequence:CCGGACATCGCCTCTGGGCTAATAGCTCGAGCTATTAGCCCAGAGGCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-861s21c1
Sequence:CCGGATGGGACAATGCCAGATATAACTCGAGTTATATCTGGCATTGTCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000130.4-5880s21c1
Sequence:CCGGGACTAAGCACTGGTATCATATCTCGAGATATGATACCAGTGCTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks