EMAIL THIS PAGE TO A FRIEND

F7

coagulation factor VII (serum prothrombin conversion accelerator)

Synonyms: SPCA
Gene ID:
Human(2155) Summary: This gene encodes coagulation factor VII which is a vitamin K-dependent factor essential for hemostasis. This factor circulates in the blood in a zymogen form, and is converted to an active form by either factor IXa, factor Xa, factor XIIa, or thrombin by minor proteolysis. Upon activation of the factor VII, a heavy chain containing a catalytic domain and a light chain containing 2 EGF-like domains are generated, and two chains are held together by a disulfide bond. In the presence of factor III and calcium ions, the activated factor then further activates the coagulation cascade by converting factor IX to factor IXa and/or factor X to factor Xa. Defects in this gene can cause coagulopathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(14068) coagulation factor VII
Rat(260320) coagulation factor VII (serum prothrombin conversion accelerator)
sheep(101118369) coagulation factor VII (serum prothrombin conversion accelerator)
Domestic Rabbit(100009399) coagulation factor VII (serum prothrombin conversion accelerator)
naked mole-rat(101706917) coagulation factor VII (serum prothrombin conversion accelerator)
domestic guinea pig(100727155) coagulation factor VII (serum prothrombin conversion accelerator)
Zebrafish(114423) coagulation factor VII
cow(617960) coagulation factor VII (serum prothrombin conversion accelerator)
domestic cat(101090581) coagulation factor VII (serum prothrombin conversion accelerator)
dog(607661) coagulation factor VII (serum prothrombin conversion accelerator)
chicken(395086) coagulation factor VII (serum prothrombin conversion accelerator)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000131 Rosetta Predictions human pricing
NM_019616 Rosetta Predictions human pricing
NM_152846 Rosetta Predictions rat pricing
NM_010172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190377 predicted 1184
2 SASI_Hs01_00190379 predicted 714
3 SASI_Hs01_00190380 predicted 1049
4 SASI_Hs01_00190381 predicted 375
5 SASI_Hs01_00190382 predicted 1019
6 SASI_Hs01_00190383 predicted 457
7 SASI_Hs01_00190384 predicted 493
8 SASI_Hs01_00190385 predicted 467
9 SASI_Hs01_00190386 predicted 720
10 SASI_Hs02_00301939 predicted 538
11 SASI_Hs01_00190378 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208034 predicted 648
2 SASI_Hs01_00208036 predicted 981
3 SASI_Hs01_00208037 predicted 953
4 SASI_Hs01_00208039 predicted 391
5 SASI_Hs01_00208040 predicted 422
6 SASI_Hs02_00352828 predicted 455
7 SASI_Hs02_00352829 predicted 307
8 SASI_Hs02_00352830 predicted 1567
9 SASI_Hs02_00352831 predicted 1620
10 SASI_Hs02_00352832 predicted 1792
11 SASI_Hs01_00208033 predicted 557
12 SASI_Hs01_00208035 predicted 662
13 SASI_Hs01_00208038 predicted 426
14 SASI_Hs01_00208041 predicted 989
15 SASI_Hs01_00208042 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092555 predicted 232
2 SASI_Rn01_00092556 predicted 1003
3 SASI_Rn01_00092557 predicted 713
4 SASI_Rn01_00092558 predicted 671
5 SASI_Rn01_00092560 predicted 518
6 SASI_Rn01_00092561 predicted 734
7 SASI_Rn01_00092562 predicted 307
8 SASI_Rn02_00268910 predicted 864
9 SASI_Rn01_00092563 predicted 231
10 SASI_Rn01_00092564 predicted 411
11 SASI_Rn01_00092559 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317949 predicted 1418
2 SASI_Mm02_00317950 predicted 497
3 SASI_Mm02_00317951 predicted 752
4 SASI_Mm02_00317952 predicted 813
5 SASI_Mm02_00317953 predicted 319
6 SASI_Mm02_00317954 predicted 287
7 SASI_Mm02_00317955 predicted 537
8 SASI_Mm02_00317956 predicted 1418
9 SASI_Mm02_00317957 predicted 360
10 SASI_Mm02_00317958 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000131
F7 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VII (serum prothrombin conversion accelerator)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000131.2-2257s1c1
Sequence:CCGGGCGGTTGTTTAGCTCTCACTTCTCGAGAAGTGAGAGCTAAACAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-1191s1c1
Sequence:CCGGCCCAAATATCACGGAGTACATCTCGAGATGTACTCCGTGATATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-730s1c1
Sequence:CCGGCAGGTCCTGTTGTTGGTGAATCTCGAGATTCACCAACAACAGGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-495s1c1
Sequence:CCGGGCTGATCTGTGTGAACGAGAACTCGAGTTCTCGTTCACACAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-423s1c1
Sequence:CCGGGCTCCAGTCCTATATCTGCTTCTCGAGAAGCAGATATAGGACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000131.3-1504s21c1
Sequence:CCGGTGGCACCAAATCCCATATATTCTCGAGAATATATGGGATTTGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000131.3-609s21c1
Sequence:CCGGCTGCACACCCACAGTTGAATACTCGAGTATTCAACTGTGGGTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000131.3-1668s21c1
Sequence:CCGGCAAGATTCAAAGAGACTAATACTCGAGTATTAGTCTCTTTGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000131
F7 MISSION shRNA shRNA Plasmid DNA
coagulation factor VII (serum prothrombin conversion accelerator)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000131.2-2257s1c1
Sequence:CCGGGCGGTTGTTTAGCTCTCACTTCTCGAGAAGTGAGAGCTAAACAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-1191s1c1
Sequence:CCGGCCCAAATATCACGGAGTACATCTCGAGATGTACTCCGTGATATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-730s1c1
Sequence:CCGGCAGGTCCTGTTGTTGGTGAATCTCGAGATTCACCAACAACAGGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-495s1c1
Sequence:CCGGGCTGATCTGTGTGAACGAGAACTCGAGTTCTCGTTCACACAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-423s1c1
Sequence:CCGGGCTCCAGTCCTATATCTGCTTCTCGAGAAGCAGATATAGGACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000131.3-1504s21c1
Sequence:CCGGTGGCACCAAATCCCATATATTCTCGAGAATATATGGGATTTGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000131.3-609s21c1
Sequence:CCGGCTGCACACCCACAGTTGAATACTCGAGTATTCAACTGTGGGTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000131.3-1668s21c1
Sequence:CCGGCAAGATTCAAAGAGACTAATACTCGAGTATTAGTCTCTTTGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000131
F7 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VII (serum prothrombin conversion accelerator)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000131.2-2257s1c1
Sequence:CCGGGCGGTTGTTTAGCTCTCACTTCTCGAGAAGTGAGAGCTAAACAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-1191s1c1
Sequence:CCGGCCCAAATATCACGGAGTACATCTCGAGATGTACTCCGTGATATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-730s1c1
Sequence:CCGGCAGGTCCTGTTGTTGGTGAATCTCGAGATTCACCAACAACAGGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-495s1c1
Sequence:CCGGGCTGATCTGTGTGAACGAGAACTCGAGTTCTCGTTCACACAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000131.2-423s1c1
Sequence:CCGGGCTCCAGTCCTATATCTGCTTCTCGAGAAGCAGATATAGGACTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000131.3-1504s21c1
Sequence:CCGGTGGCACCAAATCCCATATATTCTCGAGAATATATGGGATTTGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000131.3-609s21c1
Sequence:CCGGCTGCACACCCACAGTTGAATACTCGAGTATTCAACTGTGGGTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000131.3-1668s21c1
Sequence:CCGGCAAGATTCAAAGAGACTAATACTCGAGTATTAGTCTCTTTGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010172
F7 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VII (serum prothrombin conversion accelerator)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-541s1c1
Sequence:CCGGTGTGGGAGAATACCTGTTGTACTCGAGTACAACAGGTATTCTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-719s1c1
Sequence:CCGGGCTTCGATAATATCCGCTACTCTCGAGAGTAGCGGATATTATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-401s1c1
Sequence:CCGGAGCTGATCTGTGCAAATGAAACTCGAGTTTCATTTGCACAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-320s1c1
Sequence:CCGGGCCAGGATCATCTCAAGTCTTCTCGAGAAGACTTGAGATGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-846s1c1
Sequence:CCGGCGGCAAGATCAACCACGACATCTCGAGATGTCGTGGTTGATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010172
F7 MISSION shRNA shRNA Plasmid DNA
coagulation factor VII (serum prothrombin conversion accelerator)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-541s1c1
Sequence:CCGGTGTGGGAGAATACCTGTTGTACTCGAGTACAACAGGTATTCTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-719s1c1
Sequence:CCGGGCTTCGATAATATCCGCTACTCTCGAGAGTAGCGGATATTATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-401s1c1
Sequence:CCGGAGCTGATCTGTGCAAATGAAACTCGAGTTTCATTTGCACAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-320s1c1
Sequence:CCGGGCCAGGATCATCTCAAGTCTTCTCGAGAAGACTTGAGATGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-846s1c1
Sequence:CCGGCGGCAAGATCAACCACGACATCTCGAGATGTCGTGGTTGATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010172
F7 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VII (serum prothrombin conversion accelerator)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-541s1c1
Sequence:CCGGTGTGGGAGAATACCTGTTGTACTCGAGTACAACAGGTATTCTCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-719s1c1
Sequence:CCGGGCTTCGATAATATCCGCTACTCTCGAGAGTAGCGGATATTATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-401s1c1
Sequence:CCGGAGCTGATCTGTGCAAATGAAACTCGAGTTTCATTTGCACAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-320s1c1
Sequence:CCGGGCCAGGATCATCTCAAGTCTTCTCGAGAAGACTTGAGATGATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010172.1-846s1c1
Sequence:CCGGCGGCAAGATCAACCACGACATCTCGAGATGTCGTGGTTGATCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks