EMAIL THIS PAGE TO A FRIEND

F8

coagulation factor VIII, procoagulant component

110 Gene Product Result for
Synonyms: AHF DXS1253E F8B F8C FVIII HEMA
UniProtKB ID: P00451, Q14286, Q5HY69
Gene ID:
Human(2157) Summary: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]
Mouse(14069) coagulation factor VIII
Rat(302470) coagulation factor VIII, procoagulant component
Zebrafish(100302404) coagulation factor VIII, procoagulant component
chicken(422199) coagulation factor VIII, procoagulant component
cow(100271720) coagulation factor VIII, procoagulant component
domestic cat(101092751) coagulation factor VIII, procoagulant component
dog(403875) coagulation factor VIII, procoagulant component
sheep(100359363) coagulation factor VIII, procoagulant component
Domestic Rabbit(100303761) coagulation factor VIII, procoagulant component
domestic guinea pig(100720831) coagulation factor VIII, procoagulant component
naked mole-rat(101725450) coagulation factor VIII, procoagulant component
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158241 MISSION® esiRNA esiRNA human F8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000132 Rosetta Predictions human pricing
NM_019863 Rosetta Predictions human pricing
NM_183331 Rosetta Predictions rat pricing
NM_007977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049594 predicted 6930
2 SASI_Hs01_00049595 predicted 7637
3 SASI_Hs01_00049596 predicted 7674
4 SASI_Hs01_00049597 predicted 7405
5 SASI_Hs01_00049598 predicted 7299
6 SASI_Hs01_00049599 predicted 7610
7 SASI_Hs02_00301940 predicted 7120
8 SASI_Hs02_00301941 predicted 7500
9 SASI_Hs01_00049600 predicted 7104
10 SASI_Hs01_00049601 predicted 6953
11 SASI_Hs01_00049602 predicted 7606
12 SASI_Hs01_00049603 predicted 7570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145358 predicted 503
2 SASI_Hs01_00145359 predicted 1208
3 SASI_Hs01_00145360 predicted 1249
4 SASI_Hs01_00145361 predicted 970
5 SASI_Hs01_00145362 predicted 868
6 SASI_Hs01_00145363 predicted 1184
7 SASI_Hs02_00352894 predicted 694
8 SASI_Hs02_00352895 predicted 1073
9 SASI_Hs01_00145364 predicted 676
10 SASI_Hs01_00145365 predicted 520
11 SASI_Hs01_00145366 predicted 1171
12 SASI_Hs01_00145367 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075805 predicted 2940
2 SASI_Rn01_00075806 predicted 1945
3 SASI_Rn01_00075808 predicted 3958
4 SASI_Rn01_00075810 predicted 3761
5 SASI_Rn01_00075811 predicted 5261
6 SASI_Rn02_00269885 predicted 4545
7 SASI_Rn01_00075812 predicted 6123
8 SASI_Rn01_00075813 predicted 4131
9 SASI_Rn01_00075814 predicted 351
10 SASI_Rn02_00269886 predicted 3715
11 SASI_Rn01_00075807 predicted 4631
12 SASI_Rn01_00075809 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032603 predicted 4148
2 SASI_Mm01_00032604 predicted 7262
3 SASI_Mm01_00032605 predicted 6793
4 SASI_Mm01_00032606 predicted 7231
5 SASI_Mm01_00032607 predicted 1497
6 SASI_Mm01_00032608 predicted 1697
7 SASI_Mm01_00032610 predicted 3184
8 SASI_Mm01_00032611 predicted 5521
9 SASI_Mm02_00312879 predicted 6600
10 SASI_Mm02_00312880 predicted 4627
11 SASI_Mm01_00032609 predicted 1400
12 SASI_Mm01_00032612 predicted 1926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000132
VALIDATED
F8 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VIII, procoagulant component
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000132.3-4416s21c1
Sequence:CCGGTCCATCTATTAGACCTATATACTCGAGTATATAGGTCTAATAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000132.3-1629s21c1
Sequence:CCGGTCAAGCAAGCAGACCATATAACTCGAGTTATATGGTCTGCTTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000132.3-7617s21c1
Sequence:CCGGGTTAAGCCTCATACGTTTAAACTCGAGTTTAAACGTATGAGGCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-1082s1c1
Sequence:CCGGCCTTGGAAATCTCGCCAATAACTCGAGTTATTGGCGAGATTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000132.2-5450s1c1
Sequence:CCGGGCTCCTTTACTCAGCCCTTATCTCGAGATAAGGGCTGAGTAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000132.2-7346s1c1
Sequence:CCGGGCCTCCTGAATTAACTATCATCTCGAGATGATAGTTAATTCAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-5149s1c1
Sequence:CCGGCCAGTCTTGAAACGCCATCAACTCGAGTTGATGGCGTTTCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000132.2-4151s1c1
Sequence:CCGGCGCAACGTAGTAAGAGAGCTTCTCGAGAAGCTCTCTTACTACGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-1876s1c1
Sequence:CCGGCCTCTCCTCATCTGCTACAAACTCGAGTTTGTAGCAGATGAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000132
VALIDATED
F8 MISSION shRNA shRNA Plasmid DNA
coagulation factor VIII, procoagulant component
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000132.3-4416s21c1
Sequence:CCGGTCCATCTATTAGACCTATATACTCGAGTATATAGGTCTAATAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000132.3-1629s21c1
Sequence:CCGGTCAAGCAAGCAGACCATATAACTCGAGTTATATGGTCTGCTTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000132.3-7617s21c1
Sequence:CCGGGTTAAGCCTCATACGTTTAAACTCGAGTTTAAACGTATGAGGCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-1082s1c1
Sequence:CCGGCCTTGGAAATCTCGCCAATAACTCGAGTTATTGGCGAGATTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000132.2-5450s1c1
Sequence:CCGGGCTCCTTTACTCAGCCCTTATCTCGAGATAAGGGCTGAGTAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000132.2-7346s1c1
Sequence:CCGGGCCTCCTGAATTAACTATCATCTCGAGATGATAGTTAATTCAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-5149s1c1
Sequence:CCGGCCAGTCTTGAAACGCCATCAACTCGAGTTGATGGCGTTTCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000132.2-4151s1c1
Sequence:CCGGCGCAACGTAGTAAGAGAGCTTCTCGAGAAGCTCTCTTACTACGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-1876s1c1
Sequence:CCGGCCTCTCCTCATCTGCTACAAACTCGAGTTTGTAGCAGATGAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000132
VALIDATED
F8 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VIII, procoagulant component
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000132.3-4416s21c1
Sequence:CCGGTCCATCTATTAGACCTATATACTCGAGTATATAGGTCTAATAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000132.3-1629s21c1
Sequence:CCGGTCAAGCAAGCAGACCATATAACTCGAGTTATATGGTCTGCTTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000132.3-7617s21c1
Sequence:CCGGGTTAAGCCTCATACGTTTAAACTCGAGTTTAAACGTATGAGGCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-1082s1c1
Sequence:CCGGCCTTGGAAATCTCGCCAATAACTCGAGTTATTGGCGAGATTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000132.2-5450s1c1
Sequence:CCGGGCTCCTTTACTCAGCCCTTATCTCGAGATAAGGGCTGAGTAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000132.2-7346s1c1
Sequence:CCGGGCCTCCTGAATTAACTATCATCTCGAGATGATAGTTAATTCAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-5149s1c1
Sequence:CCGGCCAGTCTTGAAACGCCATCAACTCGAGTTGATGGCGTTTCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000132.2-4151s1c1
Sequence:CCGGCGCAACGTAGTAAGAGAGCTTCTCGAGAAGCTCTCTTACTACGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000132.2-1876s1c1
Sequence:CCGGCCTCTCCTCATCTGCTACAAACTCGAGTTTGTAGCAGATGAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007977
F8 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VIII, procoagulant component
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-2054s1c1
Sequence:CCGGCCGCTATTATTCAAGTTTCATCTCGAGATGAAACTTGAATAATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-7263s1c1
Sequence:CCGGCCACCATTACTCACTCGCTATCTCGAGATAGCGAGTGAGTAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-6792s1c1
Sequence:CCGGCCTCCAATTATTGCTCGATATCTCGAGATATCGAGCAATAATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-1106s1c1
Sequence:CCGGCGACTCTTATACACAGTCTATCTCGAGATAGACTGTGTATAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-5593s1c1
Sequence:CCGGGCTCCTTTAGTCAGCCCTTATCTCGAGATAAGGGCTGACTAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007977
F8 MISSION shRNA shRNA Plasmid DNA
coagulation factor VIII, procoagulant component
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-2054s1c1
Sequence:CCGGCCGCTATTATTCAAGTTTCATCTCGAGATGAAACTTGAATAATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-7263s1c1
Sequence:CCGGCCACCATTACTCACTCGCTATCTCGAGATAGCGAGTGAGTAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-6792s1c1
Sequence:CCGGCCTCCAATTATTGCTCGATATCTCGAGATATCGAGCAATAATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-1106s1c1
Sequence:CCGGCGACTCTTATACACAGTCTATCTCGAGATAGACTGTGTATAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-5593s1c1
Sequence:CCGGGCTCCTTTAGTCAGCCCTTATCTCGAGATAAGGGCTGACTAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007977
F8 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VIII, procoagulant component
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-2054s1c1
Sequence:CCGGCCGCTATTATTCAAGTTTCATCTCGAGATGAAACTTGAATAATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-7263s1c1
Sequence:CCGGCCACCATTACTCACTCGCTATCTCGAGATAGCGAGTGAGTAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-6792s1c1
Sequence:CCGGCCTCCAATTATTGCTCGATATCTCGAGATATCGAGCAATAATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-1106s1c1
Sequence:CCGGCGACTCTTATACACAGTCTATCTCGAGATAGACTGTGTATAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007977.1-5593s1c1
Sequence:CCGGGCTCCTTTAGTCAGCCCTTATCTCGAGATAAGGGCTGACTAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks