EMAIL THIS PAGE TO A FRIEND

F8A1

coagulation factor VIII-associated 1

28 Gene Product Result for
Synonyms: DXS522E F8A HAP40
UniProtKB ID: P23610, Q5HY66, Q8IXP3
Gene ID:
Human(8263) Summary: This gene is contained entirely within intron 22 of the factor VIII gene; spans less than 2 kb, and is transcribed in the direction opposite of factor VIII. A portion of intron 22 (int22h), containing F8A, is repeated twice extragenically closer to the Xq telomere. Although its function is unknown, the observation that this gene is conserved in the mouse implies it has some function. Unlike factor VIII, this gene is transcribed abundantly in a wide variety of cell types. [provided by RefSeq, Jul 2008]
Rat(501661) coagulation factor VIII-associated 1
cow(101902099) coagulation factor VIII-associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012151 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225001 MISSION® esiRNA esiRNA targeting human F8A1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012151 Rosetta Predictions human pricing
NM_001109323 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209460 predicted 323
2 SASI_Hs01_00209461 predicted 321
3 SASI_Hs01_00209456 predicted 397
4 SASI_Hs01_00209457 predicted 386
5 SASI_Hs01_00209458 predicted 435
6 SASI_Hs01_00209459 predicted 290
7 SASI_Hs01_00209462 predicted 389
8 SASI_Hs01_00209463 predicted 387
9 SASI_Hs01_00209464 predicted 1284
10 SASI_Hs02_00343734 predicted 1609
11 SASI_Hs01_00209465 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247294 predicted 1199
2 SASI_Rn02_00247295 predicted 1202
3 SASI_Rn02_00247296 predicted 962
4 SASI_Rn02_00247297 predicted 1099
5 SASI_Rn02_00247298 predicted 609
6 SASI_Rn02_00247299 predicted 1115
7 SASI_Rn02_00247300 predicted 1190
8 SASI_Rn02_00247301 predicted 1244
9 SASI_Rn02_00247302 predicted 217
10 SASI_Rn02_00247303 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012151
VALIDATED
F8A1 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VIII-associated 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012151.3-1200s1c1
Sequence:CCGGGATGACTTTGCCTGTTACCAACTCGAGTTGGTAACAGGCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012151.3-1469s1c1
Sequence:CCGGGCCTTTGTTTCATAGTGAGGACTCGAGTCCTCACTATGAAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1210s1c1
Sequence:CCGGCCTGTTACCAAACCTCATGCACTCGAGTGCATGAGGTTTGGTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012151.3-1138s1c1
Sequence:CCGGCCATTCACCCAGTGACTTCTTCTCGAGAAGAAGTCACTGGGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_012151.3-1411s1c1
Sequence:CCGGGACAATCCCTTTCGTCTCCTTCTCGAGAAGGAGACGAAAGGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012151.3-96s1c1
Sequence:CCGGGCTGGTATCGAACAAGCTGAACTCGAGTTCAGCTTGTTCGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012151.3-105s1c1
Sequence:CCGGGAACAAGCTGAAGAAGCGGTTCTCGAGAACCGCTTCTTCAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1286s1c1
Sequence:CCGGGTTATTCCTACTGCCGCCATACTCGAGTATGGCGGCAGTAGGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1300s1c1
Sequence:CCGGCGCCATAGGAATTATTTCGTTCTCGAGAACGAAATAATTCCTATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1570s21c1
Sequence:CCGGGTGTCTTTGTAATGGCCAAATCTCGAGATTTGGCCATTACAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1189s21c1
Sequence:CCGGCACGTTAACCAGATGACTTTGCTCGAGCAAAGTCATCTGGTTAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1313s21c1
Sequence:CCGGATTTCGTTGGCTGAACGTTACCTCGAGGTAACGTTCAGCCAACGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1264s21c1
Sequence:CCGGATCGTTCCCGCTTCTGCGTTTCTCGAGAAACGCAGAAGCGGGAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1549s21c1
Sequence:CCGGCTCACTTCTTAACATATTCCTCTCGAGAGGAATATGTTAAGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012151.3-1124s21c1
Sequence:CCGGGAGTCTGATCCATCCCATTCACTCGAGTGAATGGGATGGATCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012151
VALIDATED
F8A1 MISSION shRNA shRNA Plasmid DNA
coagulation factor VIII-associated 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012151.3-1200s1c1
Sequence:CCGGGATGACTTTGCCTGTTACCAACTCGAGTTGGTAACAGGCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012151.3-1469s1c1
Sequence:CCGGGCCTTTGTTTCATAGTGAGGACTCGAGTCCTCACTATGAAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1210s1c1
Sequence:CCGGCCTGTTACCAAACCTCATGCACTCGAGTGCATGAGGTTTGGTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012151.3-1138s1c1
Sequence:CCGGCCATTCACCCAGTGACTTCTTCTCGAGAAGAAGTCACTGGGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_012151.3-1411s1c1
Sequence:CCGGGACAATCCCTTTCGTCTCCTTCTCGAGAAGGAGACGAAAGGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012151.3-96s1c1
Sequence:CCGGGCTGGTATCGAACAAGCTGAACTCGAGTTCAGCTTGTTCGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012151.3-105s1c1
Sequence:CCGGGAACAAGCTGAAGAAGCGGTTCTCGAGAACCGCTTCTTCAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1286s1c1
Sequence:CCGGGTTATTCCTACTGCCGCCATACTCGAGTATGGCGGCAGTAGGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1300s1c1
Sequence:CCGGCGCCATAGGAATTATTTCGTTCTCGAGAACGAAATAATTCCTATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1570s21c1
Sequence:CCGGGTGTCTTTGTAATGGCCAAATCTCGAGATTTGGCCATTACAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1189s21c1
Sequence:CCGGCACGTTAACCAGATGACTTTGCTCGAGCAAAGTCATCTGGTTAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1313s21c1
Sequence:CCGGATTTCGTTGGCTGAACGTTACCTCGAGGTAACGTTCAGCCAACGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1264s21c1
Sequence:CCGGATCGTTCCCGCTTCTGCGTTTCTCGAGAAACGCAGAAGCGGGAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1549s21c1
Sequence:CCGGCTCACTTCTTAACATATTCCTCTCGAGAGGAATATGTTAAGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012151.3-1124s21c1
Sequence:CCGGGAGTCTGATCCATCCCATTCACTCGAGTGAATGGGATGGATCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012151
VALIDATED
F8A1 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VIII-associated 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012151.3-1200s1c1
Sequence:CCGGGATGACTTTGCCTGTTACCAACTCGAGTTGGTAACAGGCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012151.3-1469s1c1
Sequence:CCGGGCCTTTGTTTCATAGTGAGGACTCGAGTCCTCACTATGAAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1210s1c1
Sequence:CCGGCCTGTTACCAAACCTCATGCACTCGAGTGCATGAGGTTTGGTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012151.3-1138s1c1
Sequence:CCGGCCATTCACCCAGTGACTTCTTCTCGAGAAGAAGTCACTGGGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_012151.3-1411s1c1
Sequence:CCGGGACAATCCCTTTCGTCTCCTTCTCGAGAAGGAGACGAAAGGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012151.3-96s1c1
Sequence:CCGGGCTGGTATCGAACAAGCTGAACTCGAGTTCAGCTTGTTCGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012151.3-105s1c1
Sequence:CCGGGAACAAGCTGAAGAAGCGGTTCTCGAGAACCGCTTCTTCAGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1286s1c1
Sequence:CCGGGTTATTCCTACTGCCGCCATACTCGAGTATGGCGGCAGTAGGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012151.3-1300s1c1
Sequence:CCGGCGCCATAGGAATTATTTCGTTCTCGAGAACGAAATAATTCCTATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1570s21c1
Sequence:CCGGGTGTCTTTGTAATGGCCAAATCTCGAGATTTGGCCATTACAAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1189s21c1
Sequence:CCGGCACGTTAACCAGATGACTTTGCTCGAGCAAAGTCATCTGGTTAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1313s21c1
Sequence:CCGGATTTCGTTGGCTGAACGTTACCTCGAGGTAACGTTCAGCCAACGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1264s21c1
Sequence:CCGGATCGTTCCCGCTTCTGCGTTTCTCGAGAAACGCAGAAGCGGGAACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012151.3-1549s21c1
Sequence:CCGGCTCACTTCTTAACATATTCCTCTCGAGAGGAATATGTTAAGAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012151.3-1124s21c1
Sequence:CCGGGAGTCTGATCCATCCCATTCACTCGAGTGAATGGGATGGATCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks