EMAIL THIS PAGE TO A FRIEND

F8A2

coagulation factor VIII-associated 2

Species: Human F8A2(474383), domestic guinea pig F8a2(100718000)
Gene ID:
Human(474383) Summary: This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the middle copy. Although its function is unknown, the observation that this gene is conserved in the mouse implies it has some function. Unlike factor VIII, this gene is transcribed abundantly in a wide variety of cell types. [provided by RefSeq, Jul 2008]
domestic guinea pig(100718000) coagulation factor VIII-associated 2
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007523 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007523 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180468 predicted 921
2 SASI_Hs01_00180467 predicted 1062
3 SASI_Hs01_00180469 predicted 1034
4 SASI_Hs01_00180470 predicted 1023
5 SASI_Hs01_00180471 predicted 80
6 SASI_Hs01_00180472 predicted 969
7 SASI_Hs01_00180473 predicted 99
8 SASI_Hs01_00180474 predicted 81
9 SASI_Hs01_00180475 predicted 1064
10 SASI_Hs01_00180476 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007523
F8A2 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VIII-associated 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-888s21c1
Sequence:CCGGGAAGTACTCCTGGGAGGCTTTCTCGAGAAAGCCTCCCAGGAGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-93s21c1
Sequence:CCGGCAAGCTGAAGAAGCGGTTCCTCTCGAGAGGAACCGCTTCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-938s21c1
Sequence:CCGGAGCTTCCCGAGGAGCTCTTTCCTCGAGGAAAGAGCTCCTCGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-83s21c1
Sequence:CCGGTGGTATCGAACAAGCTGAAGACTCGAGTCTTCAGCTTGTTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-75s21c1
Sequence:CCGGCTACCGGCTGGTATCGAACAACTCGAGTTGTTCGATACCAGCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007523
F8A2 MISSION shRNA shRNA Plasmid DNA
coagulation factor VIII-associated 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-888s21c1
Sequence:CCGGGAAGTACTCCTGGGAGGCTTTCTCGAGAAAGCCTCCCAGGAGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-93s21c1
Sequence:CCGGCAAGCTGAAGAAGCGGTTCCTCTCGAGAGGAACCGCTTCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-938s21c1
Sequence:CCGGAGCTTCCCGAGGAGCTCTTTCCTCGAGGAAAGAGCTCCTCGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-83s21c1
Sequence:CCGGTGGTATCGAACAAGCTGAAGACTCGAGTCTTCAGCTTGTTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-75s21c1
Sequence:CCGGCTACCGGCTGGTATCGAACAACTCGAGTTGTTCGATACCAGCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007523
F8A2 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VIII-associated 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-888s21c1
Sequence:CCGGGAAGTACTCCTGGGAGGCTTTCTCGAGAAAGCCTCCCAGGAGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-93s21c1
Sequence:CCGGCAAGCTGAAGAAGCGGTTCCTCTCGAGAGGAACCGCTTCTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-938s21c1
Sequence:CCGGAGCTTCCCGAGGAGCTCTTTCCTCGAGGAAAGAGCTCCTCGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-83s21c1
Sequence:CCGGTGGTATCGAACAAGCTGAAGACTCGAGTCTTCAGCTTGTTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007523.1-75s21c1
Sequence:CCGGCTACCGGCTGGTATCGAACAACTCGAGTTGTTCGATACCAGCCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks