EMAIL THIS PAGE TO A FRIEND

F8A3

coagulation factor VIII-associated 3

69 Gene Product Result for
Species: Human F8A3(474384), chicken F8A3(776915)
Gene ID:
Human(474384) Summary: This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most telomeric copy. Although its function is unknown, the observation that this gene is conserved in the mouse implies it has some function. Unlike factor VIII, this gene is transcribed abundantly in a wide variety of cell types. [provided by RefSeq, Jul 2008]
chicken(776915) coagulation factor VIII-associated 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007524 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123831 predicted 924
2 SASI_Hs01_00123830 predicted 1063
3 SASI_Hs01_00123832 predicted 1033
4 SASI_Hs01_00123833 predicted 1018
5 SASI_Hs01_00123834 predicted 72
6 SASI_Hs01_00123835 predicted 975
7 SASI_Hs01_00123836 predicted 101
8 SASI_Hs01_00123837 predicted 77
9 SASI_Hs01_00123838 predicted 1070
10 SASI_Hs01_00123839 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007524
F8A3 MISSION shRNA Bacterial Glycerol Stock
coagulation factor VIII-associated 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-954s21c1
Sequence:CCGGCTTTCTGCTGCTCCAGTCTTTCTCGAGAAAGACTGGAGCAGCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-92s21c1
Sequence:CCGGACAAGCTGAAGAAGCGGTTCCCTCGAGGGAACCGCTTCTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-108s21c1
Sequence:CCGGGTTCCTGCGGAAGCCGAACGTCTCGAGACGTTCGGCTTCCGCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-726s21c1
Sequence:CCGGCGCGCTGCTTCCTCCGAACTCCTCGAGGAGTTCGGAGGAAGCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-876s21c1
Sequence:CCGGCCAGACCCTGGAGAAGTACTCCTCGAGGAGTACTTCTCCAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-937s21c1
Sequence:CCGGCAGCTTCCCGAGGAGCTCTTTCTCGAGAAAGAGCTCCTCGGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-1066s21c1
Sequence:CCGGCTTCACCTCGTTCTGCAAGAACTCGAGTTCTTGCAGAACGAGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-76s21c1
Sequence:CCGGTACCGGCTGGTATCGAACAAGCTCGAGCTTGTTCGATACCAGCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007524
F8A3 MISSION shRNA shRNA Plasmid DNA
coagulation factor VIII-associated 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-954s21c1
Sequence:CCGGCTTTCTGCTGCTCCAGTCTTTCTCGAGAAAGACTGGAGCAGCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-92s21c1
Sequence:CCGGACAAGCTGAAGAAGCGGTTCCCTCGAGGGAACCGCTTCTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-108s21c1
Sequence:CCGGGTTCCTGCGGAAGCCGAACGTCTCGAGACGTTCGGCTTCCGCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-726s21c1
Sequence:CCGGCGCGCTGCTTCCTCCGAACTCCTCGAGGAGTTCGGAGGAAGCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-876s21c1
Sequence:CCGGCCAGACCCTGGAGAAGTACTCCTCGAGGAGTACTTCTCCAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-937s21c1
Sequence:CCGGCAGCTTCCCGAGGAGCTCTTTCTCGAGAAAGAGCTCCTCGGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-1066s21c1
Sequence:CCGGCTTCACCTCGTTCTGCAAGAACTCGAGTTCTTGCAGAACGAGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-76s21c1
Sequence:CCGGTACCGGCTGGTATCGAACAAGCTCGAGCTTGTTCGATACCAGCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007524
F8A3 MISSION shRNA Lentiviral Transduction Particles
coagulation factor VIII-associated 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-954s21c1
Sequence:CCGGCTTTCTGCTGCTCCAGTCTTTCTCGAGAAAGACTGGAGCAGCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-92s21c1
Sequence:CCGGACAAGCTGAAGAAGCGGTTCCCTCGAGGGAACCGCTTCTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-108s21c1
Sequence:CCGGGTTCCTGCGGAAGCCGAACGTCTCGAGACGTTCGGCTTCCGCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-726s21c1
Sequence:CCGGCGCGCTGCTTCCTCCGAACTCCTCGAGGAGTTCGGAGGAAGCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-876s21c1
Sequence:CCGGCCAGACCCTGGAGAAGTACTCCTCGAGGAGTACTTCTCCAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-937s21c1
Sequence:CCGGCAGCTTCCCGAGGAGCTCTTTCTCGAGAAAGAGCTCCTCGGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-1066s21c1
Sequence:CCGGCTTCACCTCGTTCTGCAAGAACTCGAGTTCTTGCAGAACGAGGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007524.1-76s21c1
Sequence:CCGGTACCGGCTGGTATCGAACAAGCTCGAGCTTGTTCGATACCAGCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks