EMAIL THIS PAGE TO A FRIEND

F9

coagulation factor IX

66 Gene Product Result for
Synonyms: FIX HEMB P19 PTC THPH8
UniProtKB ID: P00740, A8K9N4, F2RM36, Q5JYJ8
Gene ID:
Human(2158) Summary: This gene encodes vitamin K-dependent coagulation factor IX that circulates in the blood as an inactive zymogen. This factor is converted to an active form by factor XIa, which excises the activation peptide and thus generates a heavy chain and a light chain held together by one or more disulfide bonds. The role of this activated factor IX in the blood coagulation cascade is to activate factor X to its active form through interactions with Ca+2 ions, membrane phospholipids, and factor VIII. Alterations of this gene, including point mutations, insertions and deletions, cause factor IX deficiency, which is a recessive X-linked disorder, also called hemophilia B or Christmas disease. [provided by RefSeq, Jul 2008]
Mouse(14071) coagulation factor IX
Rat(24946) coagulation factor IX
chicken(374258) coagulation factor IX
dog(404015) coagulation factor IX
domestic cat(493973) coagulation factor IX
cow(280688) coagulation factor IX
Horse(100054449) coagulation factor IX
domestic guinea pig(100135464) coagulation factor IX
naked mole-rat(101724977) coagulation factor IX
sheep(443316) coagulation factor IX
Domestic Rabbit(100009113) coagulation factor IX
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000133 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033601 MISSION® esiRNA esiRNA human F9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000133 Rosetta Predictions human pricing
XM_001054425 Rosetta Predictions rat pricing
XM_346365 Rosetta Predictions rat pricing
NM_007979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083545 predicted 929
2 SASI_Hs01_00083546 predicted 1017
3 SASI_Hs01_00083547 predicted 906
4 SASI_Hs01_00083548 predicted 1064
5 SASI_Hs01_00083549 predicted 395
6 SASI_Hs01_00083550 predicted 412
7 SASI_Hs01_00083552 predicted 1183
8 SASI_Hs01_00083553 predicted 1414
9 SASI_Hs02_00301942 predicted 990
10 SASI_Hs01_00083554 predicted 1111
11 SASI_Hs01_00083551 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275725 predicted 1006
2 SASI_Rn02_00275726 predicted 1040
3 SASI_Rn02_00275727 predicted 468
4 SASI_Rn02_00275728 predicted 964
5 SASI_Rn02_00275729 predicted 756
6 SASI_Rn02_00275730 predicted 1074
7 SASI_Rn02_00275731 predicted 1051
8 SASI_Rn02_00275732 predicted 392
9 SASI_Rn02_00275733 predicted 340
10 SASI_Rn02_00275734 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399334 predicted 1021
2 SASI_Rn02_00399335 predicted 1057
3 SASI_Rn02_00399336 predicted 468
4 SASI_Rn02_00399337 predicted 985
5 SASI_Rn02_00399338 predicted 711
6 SASI_Rn02_00399339 predicted 1093
7 SASI_Rn02_00399340 predicted 1073
8 SASI_Rn02_00399341 predicted 771
9 SASI_Rn02_00399342 predicted 388
10 SASI_Rn02_00399343 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113620 predicted 988
2 SASI_Mm01_00113621 predicted 1030
3 SASI_Mm01_00113622 predicted 945
4 SASI_Mm01_00113623 predicted 1473
5 SASI_Mm02_00312883 predicted 1288
6 SASI_Mm01_00113624 predicted 1178
7 SASI_Mm01_00113625 predicted 1018
8 SASI_Mm01_00113626 predicted 1467
9 SASI_Mm01_00113628 predicted 287
10 SASI_Mm01_00113629 predicted 383
11 SASI_Mm01_00113627 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000133
F9 MISSION shRNA Bacterial Glycerol Stock
coagulation factor IX
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-993s21c1
Sequence:CCGGGACGAACCCTTAGTGCTAAACCTCGAGGTTTAGCACTAAGGGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-908s21c1
Sequence:CCGGGCGAAATGTGATTCGAATTATCTCGAGATAATTCGAATCACATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-346s21c1
Sequence:CCGGGCAGTTGCAAGGATGACATTACTCGAGTAATGTCATCCTTGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000133.2-1430s1c1
Sequence:CCGGCCAAGGTTAATTCATTGGAATCTCGAGATTCCAATGAATTAACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-1373s1c1
Sequence:CCGGCCGGTATGTCAACTGGATTAACTCGAGTTAATCCAGTTGACATACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-830s1c1
Sequence:CCGGCTGTGTTGAAACTGGTGTTAACTCGAGTTAACACCAGTTTCAACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-935s1c1
Sequence:CCGGCCACAACTACAATGCAGCTATCTCGAGATAGCTGCATTGTAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-371s1c1
Sequence:CCGGCTATGAATGTTGGTGTCCCTTCTCGAGAAGGGACACCAACATTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000133
F9 MISSION shRNA shRNA Plasmid DNA
coagulation factor IX
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-993s21c1
Sequence:CCGGGACGAACCCTTAGTGCTAAACCTCGAGGTTTAGCACTAAGGGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-908s21c1
Sequence:CCGGGCGAAATGTGATTCGAATTATCTCGAGATAATTCGAATCACATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-346s21c1
Sequence:CCGGGCAGTTGCAAGGATGACATTACTCGAGTAATGTCATCCTTGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000133.2-1430s1c1
Sequence:CCGGCCAAGGTTAATTCATTGGAATCTCGAGATTCCAATGAATTAACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-1373s1c1
Sequence:CCGGCCGGTATGTCAACTGGATTAACTCGAGTTAATCCAGTTGACATACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-830s1c1
Sequence:CCGGCTGTGTTGAAACTGGTGTTAACTCGAGTTAACACCAGTTTCAACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-935s1c1
Sequence:CCGGCCACAACTACAATGCAGCTATCTCGAGATAGCTGCATTGTAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-371s1c1
Sequence:CCGGCTATGAATGTTGGTGTCCCTTCTCGAGAAGGGACACCAACATTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000133
F9 MISSION shRNA Lentiviral Transduction Particles
coagulation factor IX
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-993s21c1
Sequence:CCGGGACGAACCCTTAGTGCTAAACCTCGAGGTTTAGCACTAAGGGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-908s21c1
Sequence:CCGGGCGAAATGTGATTCGAATTATCTCGAGATAATTCGAATCACATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000133.3-346s21c1
Sequence:CCGGGCAGTTGCAAGGATGACATTACTCGAGTAATGTCATCCTTGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000133.2-1430s1c1
Sequence:CCGGCCAAGGTTAATTCATTGGAATCTCGAGATTCCAATGAATTAACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-1373s1c1
Sequence:CCGGCCGGTATGTCAACTGGATTAACTCGAGTTAATCCAGTTGACATACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-830s1c1
Sequence:CCGGCTGTGTTGAAACTGGTGTTAACTCGAGTTAACACCAGTTTCAACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-935s1c1
Sequence:CCGGCCACAACTACAATGCAGCTATCTCGAGATAGCTGCATTGTAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000133.2-371s1c1
Sequence:CCGGCTATGAATGTTGGTGTCCCTTCTCGAGAAGGGACACCAACATTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135893
F9 MISSION shRNA Bacterial Glycerol Stock
coagulation factor IX
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-979s1c1
Sequence:CCGGGCCTTGCTGGAACTGGATAAACTCGAGTTTATCCAGTTCCAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-441s1c1
Sequence:CCGGCAGTCCTGATAACAAGGTAATCTCGAGATTACCTTGTTATCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-125s1c1
Sequence:CCGGCCCGTCCAAAGAGATATAATTCTCGAGAATTATATCTCTTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-506s1c1
Sequence:CCGGCCTGTGAACCAACAGTTCCATCTCGAGATGGAACTGTTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-1295s1c1
Sequence:CCGGCAAGTTTCTTAACTGGCATTACTCGAGTAATGCCAGTTAAGAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135893
F9 MISSION shRNA shRNA Plasmid DNA
coagulation factor IX
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-979s1c1
Sequence:CCGGGCCTTGCTGGAACTGGATAAACTCGAGTTTATCCAGTTCCAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-441s1c1
Sequence:CCGGCAGTCCTGATAACAAGGTAATCTCGAGATTACCTTGTTATCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-125s1c1
Sequence:CCGGCCCGTCCAAAGAGATATAATTCTCGAGAATTATATCTCTTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-506s1c1
Sequence:CCGGCCTGTGAACCAACAGTTCCATCTCGAGATGGAACTGTTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-1295s1c1
Sequence:CCGGCAAGTTTCTTAACTGGCATTACTCGAGTAATGCCAGTTAAGAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135893
F9 MISSION shRNA Lentiviral Transduction Particles
coagulation factor IX
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-979s1c1
Sequence:CCGGGCCTTGCTGGAACTGGATAAACTCGAGTTTATCCAGTTCCAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-441s1c1
Sequence:CCGGCAGTCCTGATAACAAGGTAATCTCGAGATTACCTTGTTATCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-125s1c1
Sequence:CCGGCCCGTCCAAAGAGATATAATTCTCGAGAATTATATCTCTTTGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-506s1c1
Sequence:CCGGCCTGTGAACCAACAGTTCCATCTCGAGATGGAACTGTTGGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135893.2-1295s1c1
Sequence:CCGGCAAGTTTCTTAACTGGCATTACTCGAGTAATGCCAGTTAAGAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks