EMAIL THIS PAGE TO A FRIEND

FA2H

fatty acid 2-hydroxylase

Synonyms: FAAH FAH1 FAXDC1 SCS7 SPG35
UniProtKB ID: Q7L5A8, O75213, Q96DK1, Q9H1A5
Gene ID:
Human(79152) Summary: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.[provided by RefSeq, Mar 2010]
Mouse(338521) fatty acid 2-hydroxylase
Rat(307855) fatty acid 2-hydroxylase
Zebrafish(792257) fatty acid 2-hydroxylase
chicken(415687) fatty acid 2-hydroxylase
fruit fly(35670) fatty acid 2-hydroylase
domestic cat(101089563) fatty acid 2-hydroxylase
cow(516891) fatty acid 2-hydroxylase
dog(610417) fatty acid 2-hydroxylase
sheep(101116673) fatty acid 2-hydroxylase
naked mole-rat(101713306) fatty acid 2-hydroxylase
domestic guinea pig(100734359) fatty acid 2-hydroxylase
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024306 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049601 MISSION® esiRNA esiRNA human FA2H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024306 Rosetta Predictions human pricing
XM_001073350 Rosetta Predictions rat pricing
XM_001077628 Rosetta Predictions rat pricing
XM_226477 Rosetta Predictions rat pricing
NM_178086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063118 predicted 806
2 SASI_Hs01_00063119 predicted 1006
3 SASI_Hs01_00063120 predicted 1129
4 SASI_Hs01_00063121 predicted 1580
5 SASI_Hs01_00063122 predicted 1040
6 SASI_Hs01_00063123 predicted 345
7 SASI_Hs02_00356646 predicted 899
8 SASI_Hs01_00063125 predicted 1015
9 SASI_Hs01_00063126 predicted 1028
10 SASI_Hs01_00063127 predicted 442
11 SASI_Hs01_00063124 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342485 predicted 1632
2 SASI_Rn02_00342486 predicted 393
3 SASI_Rn02_00342487 predicted 664
4 SASI_Rn02_00342488 predicted 1003
5 SASI_Rn02_00342489 predicted 372
6 SASI_Rn02_00342490 predicted 805
7 SASI_Rn02_00342491 predicted 1450
8 SASI_Rn02_00342492 predicted 1032
9 SASI_Rn02_00342493 predicted 1397
10 SASI_Rn02_00342494 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357839 predicted 576
2 SASI_Rn02_00357840 predicted 674
3 SASI_Rn02_00357841 predicted 797
4 SASI_Rn02_00357842 predicted 962
5 SASI_Rn02_00357843 predicted 528
6 SASI_Rn02_00357844 predicted 814
7 SASI_Rn02_00357845 predicted 786
8 SASI_Rn02_00357846 predicted 667
9 SASI_Rn02_00357847 predicted 538
10 SASI_Rn02_00357848 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125713 predicted 1161
2 SASI_Rn01_00125714 predicted 3313
3 SASI_Rn01_00125715 predicted 2921
4 SASI_Rn01_00125716 predicted 5352
5 SASI_Rn01_00125717 predicted 1197
6 SASI_Rn01_00125718 predicted 5192
7 SASI_Rn01_00125719 predicted 1479
8 SASI_Rn01_00125720 predicted 5325
9 SASI_Rn01_00125721 predicted 4544
10 SASI_Rn01_00125722 predicted 3006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173286 predicted 716
2 SASI_Mm01_00173289 predicted 899
3 SASI_Mm01_00173290 predicted 665
4 SASI_Mm02_00348560 predicted 1112
5 SASI_Mm01_00173291 predicted 1398
6 SASI_Mm01_00173292 predicted 391
7 SASI_Mm01_00173293 predicted 677
8 SASI_Mm01_00173294 predicted 984
9 SASI_Mm01_00173295 predicted 1085
10 SASI_Mm02_00348561 predicted 859
11 SASI_Mm01_00173287 predicted 1118
12 SASI_Mm01_00173288 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024306
FA2H MISSION shRNA Bacterial Glycerol Stock
fatty acid 2-hydroxylase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-667s1c1
Sequence:CCGGCACGTCATTTACAACAGAGTACTCGAGTACTCTGTTGTAAATGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024306.2-2150s1c1
Sequence:CCGGCCCTTTCTAATCCTACATGTTCTCGAGAACATGTAGGATTAGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-371s1c1
Sequence:CCGGGAGGAAACTCAGAAGACAGATCTCGAGATCTGTCTTCTGAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024306.2-2256s1c1
Sequence:CCGGGCCAAGTGTAAAGGCTAAAGACTCGAGTCTTTAGCCTTTACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-802s1c1
Sequence:CCGGCGACAGCTATTACCTCATCATCTCGAGATGATGAGGTAATAGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-1109s21c1
Sequence:CCGGATTTGGTATCAGCACTAAATTCTCGAGAATTTAGTGCTGATACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-995s21c1
Sequence:CCGGCCTCTATGACATGACCCATTACTCGAGTAATGGGTCATGTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-611s21c1
Sequence:CCGGGTATCTCAGCTGGTCCTACTACTCGAGTAGTAGGACCAGCTGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024306
FA2H MISSION shRNA shRNA Plasmid DNA
fatty acid 2-hydroxylase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-667s1c1
Sequence:CCGGCACGTCATTTACAACAGAGTACTCGAGTACTCTGTTGTAAATGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024306.2-2150s1c1
Sequence:CCGGCCCTTTCTAATCCTACATGTTCTCGAGAACATGTAGGATTAGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-371s1c1
Sequence:CCGGGAGGAAACTCAGAAGACAGATCTCGAGATCTGTCTTCTGAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024306.2-2256s1c1
Sequence:CCGGGCCAAGTGTAAAGGCTAAAGACTCGAGTCTTTAGCCTTTACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-802s1c1
Sequence:CCGGCGACAGCTATTACCTCATCATCTCGAGATGATGAGGTAATAGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-1109s21c1
Sequence:CCGGATTTGGTATCAGCACTAAATTCTCGAGAATTTAGTGCTGATACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-995s21c1
Sequence:CCGGCCTCTATGACATGACCCATTACTCGAGTAATGGGTCATGTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-611s21c1
Sequence:CCGGGTATCTCAGCTGGTCCTACTACTCGAGTAGTAGGACCAGCTGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024306
FA2H MISSION shRNA Lentiviral Transduction Particles
fatty acid 2-hydroxylase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-667s1c1
Sequence:CCGGCACGTCATTTACAACAGAGTACTCGAGTACTCTGTTGTAAATGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024306.2-2150s1c1
Sequence:CCGGCCCTTTCTAATCCTACATGTTCTCGAGAACATGTAGGATTAGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-371s1c1
Sequence:CCGGGAGGAAACTCAGAAGACAGATCTCGAGATCTGTCTTCTGAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024306.2-2256s1c1
Sequence:CCGGGCCAAGTGTAAAGGCTAAAGACTCGAGTCTTTAGCCTTTACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024306.2-802s1c1
Sequence:CCGGCGACAGCTATTACCTCATCATCTCGAGATGATGAGGTAATAGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-1109s21c1
Sequence:CCGGATTTGGTATCAGCACTAAATTCTCGAGAATTTAGTGCTGATACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-995s21c1
Sequence:CCGGCCTCTATGACATGACCCATTACTCGAGTAATGGGTCATGTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024306.3-611s21c1
Sequence:CCGGGTATCTCAGCTGGTCCTACTACTCGAGTAGTAGGACCAGCTGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178086
FA2H MISSION shRNA Bacterial Glycerol Stock
fatty acid 2-hydroxylase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-894s1c1
Sequence:CCGGCTCCCTAGTGATTGCCTTCTTCTCGAGAAGAAGGCAATCACTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-798s1c1
Sequence:CCGGCAGCCATTACCTCATCATGTTCTCGAGAACATGATGAGGTAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178086.2-2218s1c1
Sequence:CCGGCCTATGTATTGAGCTTATGTACTCGAGTACATAAGCTCAATACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-1078s1c1
Sequence:CCGGCATCACTTCGAATACCAGAAACTCGAGTTTCTGGTATTCGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-661s1c1
Sequence:CCGGGCATCACTCACAAGAGAGTATCTCGAGATACTCTCTTGTGAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-896s1c1
Sequence:CCGGCCCTAGTGATTGCCTTCTTCTCTCGAGAGAAGAAGGCAATCACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-660s1c1
Sequence:CCGGCGCATCACTCACAAGAGAGTACTCGAGTACTCTCTTGTGAGTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-1086s1c1
Sequence:CCGGCGAATACCAGAAATCAGGGTTCTCGAGAACCCTGATTTCTGGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178086.2-1672s1c1
Sequence:CCGGCCAAGAAGAAACAGCATGATTCTCGAGAATCATGCTGTTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178086.2-2206s1c1
Sequence:CCGGGCCCTTTCTAATCCTATGTATCTCGAGATACATAGGATTAGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-478s1c1
Sequence:CCGGGAGAAGTATGATGAGTGGGTTCTCGAGAACCCACTCATCATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178086
FA2H MISSION shRNA shRNA Plasmid DNA
fatty acid 2-hydroxylase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-894s1c1
Sequence:CCGGCTCCCTAGTGATTGCCTTCTTCTCGAGAAGAAGGCAATCACTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-798s1c1
Sequence:CCGGCAGCCATTACCTCATCATGTTCTCGAGAACATGATGAGGTAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178086.2-2218s1c1
Sequence:CCGGCCTATGTATTGAGCTTATGTACTCGAGTACATAAGCTCAATACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-1078s1c1
Sequence:CCGGCATCACTTCGAATACCAGAAACTCGAGTTTCTGGTATTCGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-661s1c1
Sequence:CCGGGCATCACTCACAAGAGAGTATCTCGAGATACTCTCTTGTGAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-896s1c1
Sequence:CCGGCCCTAGTGATTGCCTTCTTCTCTCGAGAGAAGAAGGCAATCACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-660s1c1
Sequence:CCGGCGCATCACTCACAAGAGAGTACTCGAGTACTCTCTTGTGAGTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-1086s1c1
Sequence:CCGGCGAATACCAGAAATCAGGGTTCTCGAGAACCCTGATTTCTGGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178086.2-1672s1c1
Sequence:CCGGCCAAGAAGAAACAGCATGATTCTCGAGAATCATGCTGTTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178086.2-2206s1c1
Sequence:CCGGGCCCTTTCTAATCCTATGTATCTCGAGATACATAGGATTAGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-478s1c1
Sequence:CCGGGAGAAGTATGATGAGTGGGTTCTCGAGAACCCACTCATCATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178086
FA2H MISSION shRNA Lentiviral Transduction Particles
fatty acid 2-hydroxylase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-894s1c1
Sequence:CCGGCTCCCTAGTGATTGCCTTCTTCTCGAGAAGAAGGCAATCACTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-798s1c1
Sequence:CCGGCAGCCATTACCTCATCATGTTCTCGAGAACATGATGAGGTAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178086.2-2218s1c1
Sequence:CCGGCCTATGTATTGAGCTTATGTACTCGAGTACATAAGCTCAATACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-1078s1c1
Sequence:CCGGCATCACTTCGAATACCAGAAACTCGAGTTTCTGGTATTCGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178086.2-661s1c1
Sequence:CCGGGCATCACTCACAAGAGAGTATCTCGAGATACTCTCTTGTGAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-896s1c1
Sequence:CCGGCCCTAGTGATTGCCTTCTTCTCTCGAGAGAAGAAGGCAATCACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-660s1c1
Sequence:CCGGCGCATCACTCACAAGAGAGTACTCGAGTACTCTCTTGTGAGTGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-1086s1c1
Sequence:CCGGCGAATACCAGAAATCAGGGTTCTCGAGAACCCTGATTTCTGGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197600    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178086.2-1672s1c1
Sequence:CCGGCCAAGAAGAAACAGCATGATTCTCGAGAATCATGCTGTTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178086.2-2206s1c1
Sequence:CCGGGCCCTTTCTAATCCTATGTATCTCGAGATACATAGGATTAGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178086.2-478s1c1
Sequence:CCGGGAGAAGTATGATGAGTGGGTTCTCGAGAACCCACTCATCATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks