EMAIL THIS PAGE TO A FRIEND

FAAH2

fatty acid amide hydrolase 2

44 Gene Product Result for
Synonyms: AMDD
UniProtKB ID: Q6GMR7, Q86VT2, Q96N98
Gene ID:
Human(158584) Summary: This gene encodes a fatty acid amide hydrolase that shares a conserved protein motif with the amidase signature family of enzymes. The encoded enzyme is able to catalyze the hydrolysis of a broad range of bioactive lipids, including those from the three main classes of fatty acid amides; N-acylethanolamines, fatty acid primary amides and N-acyl amino acids. This enzyme has a preference for monounsaturated acyl chains as a substrate.[provided by RefSeq, Sep 2009]
chicken(100859568) fatty acid amide hydrolase 2
naked mole-rat(101713363) fatty acid amide hydrolase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174912 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048751 MISSION® esiRNA esiRNA human FAAH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174912 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112794 predicted 306
2 SASI_Hs01_00112795 predicted 640
3 SASI_Hs02_00368820 predicted 1005
4 SASI_Hs01_00112798 predicted 1087
5 SASI_Hs01_00112799 predicted 526
6 SASI_Hs01_00112800 predicted 640
7 SASI_Hs01_00112801 predicted 505
8 SASI_Hs01_00112802 predicted 659
9 SASI_Hs02_00368821 predicted 704
10 SASI_Hs02_00368822 predicted 716
11 SASI_Hs01_00112796 predicted 1512
12 SASI_Hs01_00112797 predicted 1430
13 SASI_Hs01_00112803 predicted 1499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174912
FAAH2 MISSION shRNA Bacterial Glycerol Stock
fatty acid amide hydrolase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174912.2-705s1c1
Sequence:CCGGCCCATATGATTTACAGCATATCTCGAGATATGCTGTAAATCATATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-1200s1c1
Sequence:CCGGGATCGCAATGATGTCAGCAAACTCGAGTTTGCTGACATCATTGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-320s1c1
Sequence:CCGGGTATAGATGTTGTTCAGGCTTCTCGAGAAGCCTGAACAACATCTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-345s1c1
Sequence:CCGGCAACAGAATCAAGGACGTGAACTCGAGTTCACGTCCTTGATTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-1371s1c1
Sequence:CCGGGCTCAGATATAGCAATGAGAACTCGAGTTCTCATTGCTATATCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1149s21c1
Sequence:CCGGGTGGTTCACCTTGAAACTATTCTCGAGAATAGTTTCAAGGTGAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1080s21c1
Sequence:CCGGGAACATGATGGAGGCTCATTTCTCGAGAAATGAGCCTCCATCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1034s21c1
Sequence:CCGGACTAGACACAAAGGTACATTTCTCGAGAAATGTACCTTTGTGTCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-223s21c1
Sequence:CCGGGCCGAGCAGCTTTAGTCTTAGCTCGAGCTAAGACTAAAGCTGCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1441s21c1
Sequence:CCGGTGGAAGAAAGCCTGCGTAAAGCTCGAGCTTTACGCAGGCTTTCTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-954s21c1
Sequence:CCGGACTGGTCCTATGTGCCGTTATCTCGAGATAACGGCACATAGGACCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174912
FAAH2 MISSION shRNA shRNA Plasmid DNA
fatty acid amide hydrolase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174912.2-705s1c1
Sequence:CCGGCCCATATGATTTACAGCATATCTCGAGATATGCTGTAAATCATATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-1200s1c1
Sequence:CCGGGATCGCAATGATGTCAGCAAACTCGAGTTTGCTGACATCATTGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-320s1c1
Sequence:CCGGGTATAGATGTTGTTCAGGCTTCTCGAGAAGCCTGAACAACATCTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-345s1c1
Sequence:CCGGCAACAGAATCAAGGACGTGAACTCGAGTTCACGTCCTTGATTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-1371s1c1
Sequence:CCGGGCTCAGATATAGCAATGAGAACTCGAGTTCTCATTGCTATATCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1149s21c1
Sequence:CCGGGTGGTTCACCTTGAAACTATTCTCGAGAATAGTTTCAAGGTGAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1080s21c1
Sequence:CCGGGAACATGATGGAGGCTCATTTCTCGAGAAATGAGCCTCCATCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1034s21c1
Sequence:CCGGACTAGACACAAAGGTACATTTCTCGAGAAATGTACCTTTGTGTCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-223s21c1
Sequence:CCGGGCCGAGCAGCTTTAGTCTTAGCTCGAGCTAAGACTAAAGCTGCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1441s21c1
Sequence:CCGGTGGAAGAAAGCCTGCGTAAAGCTCGAGCTTTACGCAGGCTTTCTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-954s21c1
Sequence:CCGGACTGGTCCTATGTGCCGTTATCTCGAGATAACGGCACATAGGACCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174912
FAAH2 MISSION shRNA Lentiviral Transduction Particles
fatty acid amide hydrolase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174912.2-705s1c1
Sequence:CCGGCCCATATGATTTACAGCATATCTCGAGATATGCTGTAAATCATATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-1200s1c1
Sequence:CCGGGATCGCAATGATGTCAGCAAACTCGAGTTTGCTGACATCATTGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-320s1c1
Sequence:CCGGGTATAGATGTTGTTCAGGCTTCTCGAGAAGCCTGAACAACATCTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-345s1c1
Sequence:CCGGCAACAGAATCAAGGACGTGAACTCGAGTTCACGTCCTTGATTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174912.2-1371s1c1
Sequence:CCGGGCTCAGATATAGCAATGAGAACTCGAGTTCTCATTGCTATATCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1149s21c1
Sequence:CCGGGTGGTTCACCTTGAAACTATTCTCGAGAATAGTTTCAAGGTGAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1080s21c1
Sequence:CCGGGAACATGATGGAGGCTCATTTCTCGAGAAATGAGCCTCCATCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1034s21c1
Sequence:CCGGACTAGACACAAAGGTACATTTCTCGAGAAATGTACCTTTGTGTCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-223s21c1
Sequence:CCGGGCCGAGCAGCTTTAGTCTTAGCTCGAGCTAAGACTAAAGCTGCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-1441s21c1
Sequence:CCGGTGGAAGAAAGCCTGCGTAAAGCTCGAGCTTTACGCAGGCTTTCTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174912.3-954s21c1
Sequence:CCGGACTGGTCCTATGTGCCGTTATCTCGAGATAACGGCACATAGGACCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)