EMAIL THIS PAGE TO A FRIEND

FAAH

fatty acid amide hydrolase

63 Gene Product Result for
Synonyms: FAAH-1
UniProtKB ID: O00519, D3DQ19, Q52M86, Q5TDF8
Gene ID:
Human(2166) Summary: This gene encodes a protein that is responsible for the hydrolysis of a number of primary and secondary fatty acid amides, including the neuromodulatory compounds anandamide and oleamide. [provided by RefSeq, Jul 2008]
Mouse(14073) fatty acid amide hydrolase
Rat(29347) fatty acid amide hydrolase
Zebrafish(569067) fatty acid amide hydrolase
Thale Cress(836565) fatty acid amide hydrolase
chicken(424614) fatty acid amide hydrolase
cow(540007) fatty acid amide hydrolase
Horse(100051756) fatty acid amide hydrolase
dog(482510) fatty acid amide hydrolase
domestic guinea pig(100732162) fatty acid amide hydrolase
naked mole-rat(101722224) fatty acid amide hydrolase
Domestic Rabbit(100343219) fatty acid amide hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098921 MISSION® esiRNA esiRNA human FAAH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001441 Rosetta Predictions human pricing
NM_024132 Rosetta Predictions rat pricing
NM_010173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111338 predicted 1424
2 SASI_Hs01_00111339 predicted 1062
3 SASI_Hs02_00331849 predicted 1677
4 SASI_Hs01_00111340 predicted 1332
5 SASI_Hs01_00111342 predicted 872
6 SASI_Hs01_00111343 predicted 1809
7 SASI_Hs01_00111344 predicted 772
8 SASI_Hs01_00111345 predicted 1381
9 SASI_Hs01_00111346 predicted 320
10 SASI_Hs01_00111347 predicted 1559
11 SASI_Hs01_00111341 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101654 predicted 1389
2 SASI_Rn01_00101656 predicted 634
3 SASI_Rn01_00101657 predicted 729
4 SASI_Rn01_00101658 predicted 1360
5 SASI_Rn01_00101659 predicted 1137
6 SASI_Rn02_00263851 predicted 1425
7 SASI_Rn01_00101660 predicted 1133
8 SASI_Rn01_00101661 predicted 937
9 SASI_Rn01_00101662 predicted 1047
10 SASI_Rn01_00101663 predicted 747
11 SASI_Rn01_00101655 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128728 predicted 1539
2 SASI_Mm01_00128729 predicted 1326
3 SASI_Mm02_00317959 predicted 1632
4 SASI_Mm01_00128731 predicted 725
5 SASI_Mm01_00128732 predicted 1224
6 SASI_Mm01_00128733 predicted 1721
7 SASI_Mm01_00128734 predicted 1108
8 SASI_Mm01_00128735 predicted 1144
9 SASI_Mm01_00128736 predicted 909
10 SASI_Mm01_00128737 predicted 1713
11 SASI_Mm01_00128730 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001441
FAAH MISSION shRNA Bacterial Glycerol Stock
fatty acid amide hydrolase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-1430s21c1
Sequence:CCGGGAGATCGAGGTGTACCGCAAACTCGAGTTTGCGGTACACCTCGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-507s21c1
Sequence:CCGGAGGAGTGCTTCACCTACAAGGCTCGAGCCTTGTAGGTGAAGCACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-1288s21c1
Sequence:CCGGGGACCTGGTCTCAATTCTGAACTCGAGTTCAGAATTGAGACCAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-402s21c1
Sequence:CCGGTGAACAAAGGGACCAACTGTGCTCGAGCACAGTTGGTCCCTTTGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-597s1c1
Sequence:CCGGCCACAGTCCATGTTCAGCTATCTCGAGATAGCTGAACATGGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1019s1c1
Sequence:CCGGGTACTATGAGACTGACAACTACTCGAGTAGTTGTCAGTCTCATAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1706s1c1
Sequence:CCGGAGAAGAGTTGTGTCTGCGGTTCTCGAGAACCGCAGACACAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1505s1c1
Sequence:CCGGCGTCAGCTACACTATGCTGTACTCGAGTACAGCATAGTGTAGCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-323s1c1
Sequence:CCGGGCTCTTCACCTATGTGGGAAACTCGAGTTTCCCACATAGGTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001441
FAAH MISSION shRNA shRNA Plasmid DNA
fatty acid amide hydrolase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-1430s21c1
Sequence:CCGGGAGATCGAGGTGTACCGCAAACTCGAGTTTGCGGTACACCTCGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-507s21c1
Sequence:CCGGAGGAGTGCTTCACCTACAAGGCTCGAGCCTTGTAGGTGAAGCACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-1288s21c1
Sequence:CCGGGGACCTGGTCTCAATTCTGAACTCGAGTTCAGAATTGAGACCAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-402s21c1
Sequence:CCGGTGAACAAAGGGACCAACTGTGCTCGAGCACAGTTGGTCCCTTTGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-597s1c1
Sequence:CCGGCCACAGTCCATGTTCAGCTATCTCGAGATAGCTGAACATGGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1019s1c1
Sequence:CCGGGTACTATGAGACTGACAACTACTCGAGTAGTTGTCAGTCTCATAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1706s1c1
Sequence:CCGGAGAAGAGTTGTGTCTGCGGTTCTCGAGAACCGCAGACACAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1505s1c1
Sequence:CCGGCGTCAGCTACACTATGCTGTACTCGAGTACAGCATAGTGTAGCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-323s1c1
Sequence:CCGGGCTCTTCACCTATGTGGGAAACTCGAGTTTCCCACATAGGTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001441
FAAH MISSION shRNA Lentiviral Transduction Particles
fatty acid amide hydrolase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-1430s21c1
Sequence:CCGGGAGATCGAGGTGTACCGCAAACTCGAGTTTGCGGTACACCTCGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-507s21c1
Sequence:CCGGAGGAGTGCTTCACCTACAAGGCTCGAGCCTTGTAGGTGAAGCACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-1288s21c1
Sequence:CCGGGGACCTGGTCTCAATTCTGAACTCGAGTTCAGAATTGAGACCAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001441.2-402s21c1
Sequence:CCGGTGAACAAAGGGACCAACTGTGCTCGAGCACAGTTGGTCCCTTTGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-597s1c1
Sequence:CCGGCCACAGTCCATGTTCAGCTATCTCGAGATAGCTGAACATGGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1019s1c1
Sequence:CCGGGTACTATGAGACTGACAACTACTCGAGTAGTTGTCAGTCTCATAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1706s1c1
Sequence:CCGGAGAAGAGTTGTGTCTGCGGTTCTCGAGAACCGCAGACACAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-1505s1c1
Sequence:CCGGCGTCAGCTACACTATGCTGTACTCGAGTACAGCATAGTGTAGCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001441.1-323s1c1
Sequence:CCGGGCTCTTCACCTATGTGGGAAACTCGAGTTTCCCACATAGGTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010173
VALIDATED
FAAH MISSION shRNA Bacterial Glycerol Stock
fatty acid amide hydrolase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1603s21c1
Sequence:CCGGTGTATCGCCAGTCCGTCATTGCTCGAGCAATGACGGACTGGCGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1216s21c1
Sequence:CCGGCCCTTCGTGTGGGATACTATGCTCGAGCATAGTATCCCACACGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-819s21c1
Sequence:CCGGCTAAGCTATGACTGCAGTAACCTCGAGGTTACTGCAGTCATAGCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1718s21c1
Sequence:CCGGCAGCTACACTGTTCTCTATAACTCGAGTTATAGAGAACAGTGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010173.2-3068s1c1
Sequence:CCGGGCAGATTTATTTCTAGCGAATCTCGAGATTCGCTAGAAATAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1798s1c1
Sequence:CCGGGCCCAGATGGAACACTACAAACTCGAGTTTGTAGTGTTCCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010173.2-534s1c1
Sequence:CCGGGCTCTTTACCTACCTGGGAAACTCGAGTTTCCCAGGTAGGTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1117s1c1
Sequence:CCGGGCATTGTGCATGAAAGCCCTACTCGAGTAGGGCTTTCATGCACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1330s1c1
Sequence:CCGGCCCTTCTTACCAAACAACATACTCGAGTATGTTGTTTGGTAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010173
VALIDATED
FAAH MISSION shRNA shRNA Plasmid DNA
fatty acid amide hydrolase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1603s21c1
Sequence:CCGGTGTATCGCCAGTCCGTCATTGCTCGAGCAATGACGGACTGGCGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1216s21c1
Sequence:CCGGCCCTTCGTGTGGGATACTATGCTCGAGCATAGTATCCCACACGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-819s21c1
Sequence:CCGGCTAAGCTATGACTGCAGTAACCTCGAGGTTACTGCAGTCATAGCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1718s21c1
Sequence:CCGGCAGCTACACTGTTCTCTATAACTCGAGTTATAGAGAACAGTGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010173.2-3068s1c1
Sequence:CCGGGCAGATTTATTTCTAGCGAATCTCGAGATTCGCTAGAAATAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1798s1c1
Sequence:CCGGGCCCAGATGGAACACTACAAACTCGAGTTTGTAGTGTTCCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010173.2-534s1c1
Sequence:CCGGGCTCTTTACCTACCTGGGAAACTCGAGTTTCCCAGGTAGGTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1117s1c1
Sequence:CCGGGCATTGTGCATGAAAGCCCTACTCGAGTAGGGCTTTCATGCACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1330s1c1
Sequence:CCGGCCCTTCTTACCAAACAACATACTCGAGTATGTTGTTTGGTAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010173
VALIDATED
FAAH MISSION shRNA Lentiviral Transduction Particles
fatty acid amide hydrolase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1603s21c1
Sequence:CCGGTGTATCGCCAGTCCGTCATTGCTCGAGCAATGACGGACTGGCGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1216s21c1
Sequence:CCGGCCCTTCGTGTGGGATACTATGCTCGAGCATAGTATCCCACACGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-819s21c1
Sequence:CCGGCTAAGCTATGACTGCAGTAACCTCGAGGTTACTGCAGTCATAGCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010173.4-1718s21c1
Sequence:CCGGCAGCTACACTGTTCTCTATAACTCGAGTTATAGAGAACAGTGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010173.2-3068s1c1
Sequence:CCGGGCAGATTTATTTCTAGCGAATCTCGAGATTCGCTAGAAATAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1798s1c1
Sequence:CCGGGCCCAGATGGAACACTACAAACTCGAGTTTGTAGTGTTCCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010173.2-534s1c1
Sequence:CCGGGCTCTTTACCTACCTGGGAAACTCGAGTTTCCCAGGTAGGTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1117s1c1
Sequence:CCGGGCATTGTGCATGAAAGCCCTACTCGAGTAGGGCTTTCATGCACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010173.2-1330s1c1
Sequence:CCGGCCCTTCTTACCAAACAACATACTCGAGTATGTTGTTTGGTAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)