EMAIL THIS PAGE TO A FRIEND

FABP12

fatty acid binding protein 12

49 Gene Product Result for
UniProtKB ID: A6NFH5, B7SUN0
Gene ID:
Mouse(75497) fatty acid binding protein 12
Rat(499570) fatty acid binding protein 12
dog(487017) fatty acid binding protein 12
domestic cat(101087965) fatty acid binding protein 12
cow(100300024) fatty acid binding protein 12
sheep(101113600) fatty acid binding protein 12
domestic guinea pig(100723889) fatty acid binding protein 12
naked mole-rat(101706442) fatty acid binding protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105281 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151251 MISSION® esiRNA esiRNA human FABP12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105281 Rosetta Predictions human pricing
XM_929407 Rosetta Predictions human pricing
NM_001134614 Rosetta Predictions rat pricing
NM_029310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324104 predicted 196
2 SASI_Hs02_00324105 predicted 109
3 SASI_Hs02_00324106 predicted 85
4 SASI_Hs02_00324107 predicted 85
5 SASI_Hs02_00324108 predicted 290
6 SASI_Hs02_00324109 predicted 359
7 SASI_Hs02_00324110 predicted 134
8 SASI_Hs02_00324111 predicted 9
9 SASI_Hs02_00324112 predicted 109
10 SASI_Hs02_00324113 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279999 predicted 251
2 SASI_Hs01_00280000 predicted 247
3 SASI_Hs01_00280001 predicted 202
4 SASI_Hs01_00280002 predicted 257
5 SASI_Hs01_00280003 predicted 249
6 SASI_Hs01_00280004 predicted 248
7 SASI_Hs01_00280005 predicted 216
8 SASI_Hs01_00280006 predicted 217
9 SASI_Hs01_00280007 predicted 247
10 SASI_Hs01_00280008 predicted 66
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257619 predicted 494
2 SASI_Rn02_00257620 predicted 258
3 SASI_Rn02_00257621 predicted 321
4 SASI_Rn02_00257622 predicted 491
5 SASI_Rn02_00257623 predicted 372
6 SASI_Rn02_00257624 predicted 254
7 SASI_Rn02_00257625 predicted 332
8 SASI_Rn02_00257626 predicted 450
9 SASI_Rn02_00257627 predicted 321
10 SASI_Rn02_00257628 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033457 predicted 741
2 SASI_Mm01_00033458 predicted 988
3 SASI_Mm01_00033459 predicted 949
4 SASI_Mm01_00033460 predicted 936
5 SASI_Mm01_00033461 predicted 828
6 SASI_Mm01_00033462 predicted 561
7 SASI_Mm01_00033463 predicted 564
8 SASI_Mm01_00033464 predicted 329
9 SASI_Mm01_00033465 predicted 704
10 SASI_Mm01_00033466 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029310
FABP12 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029310.1-955s1c1
Sequence:CCGGCCGCTCAATAAGCATAGTCAACTCGAGTTGACTATGCTTATTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-382s1c1
Sequence:CCGGTGAAGGAATTGGGAGTAGGAACTCGAGTTCCTACTCCCAATTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-575s1c1
Sequence:CCGGGATCTTAGATAATGACTCCTTCTCGAGAAGGAGTCATTATCTAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-686s1c1
Sequence:CCGGTGTCACCTGTACCCGAACATACTCGAGTATGTTCGGGTACAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-664s1c1
Sequence:CCGGTGGTGGAAAGTGCAGTGAATACTCGAGTATTCACTGCACTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029310
FABP12 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029310.1-955s1c1
Sequence:CCGGCCGCTCAATAAGCATAGTCAACTCGAGTTGACTATGCTTATTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-382s1c1
Sequence:CCGGTGAAGGAATTGGGAGTAGGAACTCGAGTTCCTACTCCCAATTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-575s1c1
Sequence:CCGGGATCTTAGATAATGACTCCTTCTCGAGAAGGAGTCATTATCTAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-686s1c1
Sequence:CCGGTGTCACCTGTACCCGAACATACTCGAGTATGTTCGGGTACAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-664s1c1
Sequence:CCGGTGGTGGAAAGTGCAGTGAATACTCGAGTATTCACTGCACTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029310
FABP12 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029310.1-955s1c1
Sequence:CCGGCCGCTCAATAAGCATAGTCAACTCGAGTTGACTATGCTTATTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-382s1c1
Sequence:CCGGTGAAGGAATTGGGAGTAGGAACTCGAGTTCCTACTCCCAATTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-575s1c1
Sequence:CCGGGATCTTAGATAATGACTCCTTCTCGAGAAGGAGTCATTATCTAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-686s1c1
Sequence:CCGGTGTCACCTGTACCCGAACATACTCGAGTATGTTCGGGTACAGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029310.1-664s1c1
Sequence:CCGGTGGTGGAAAGTGCAGTGAATACTCGAGTATTCACTGCACTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105281
FABP12 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-116s21c1
Sequence:CCGGCCACTGTGACCATCAGTACAGCTCGAGCTGTACTGATGGTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-138s21c1
Sequence:CCGGTGGAGATGTCATCACAATAAACTCGAGTTTATTGTGATGACATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-59s21c1
Sequence:CCGGACATGAAGGAGCTGGGTATAGCTCGAGCTATACCCAGCTCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-246s21c1
Sequence:CCGGGAGTAAAGTAACCTTAGATAACTCGAGTTATCTAAGGTTACTTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-202s21c1
Sequence:CCGGGGAGAAGAGTTTGAGGAAATCCTCGAGGATTTCCTCAAACTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105281
FABP12 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-116s21c1
Sequence:CCGGCCACTGTGACCATCAGTACAGCTCGAGCTGTACTGATGGTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-138s21c1
Sequence:CCGGTGGAGATGTCATCACAATAAACTCGAGTTTATTGTGATGACATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-59s21c1
Sequence:CCGGACATGAAGGAGCTGGGTATAGCTCGAGCTATACCCAGCTCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-246s21c1
Sequence:CCGGGAGTAAAGTAACCTTAGATAACTCGAGTTATCTAAGGTTACTTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-202s21c1
Sequence:CCGGGGAGAAGAGTTTGAGGAAATCCTCGAGGATTTCCTCAAACTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105281
FABP12 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-116s21c1
Sequence:CCGGCCACTGTGACCATCAGTACAGCTCGAGCTGTACTGATGGTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-138s21c1
Sequence:CCGGTGGAGATGTCATCACAATAAACTCGAGTTTATTGTGATGACATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-59s21c1
Sequence:CCGGACATGAAGGAGCTGGGTATAGCTCGAGCTATACCCAGCTCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-246s21c1
Sequence:CCGGGAGTAAAGTAACCTTAGATAACTCGAGTTATCTAAGGTTACTTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105281.1-202s21c1
Sequence:CCGGGGAGAAGAGTTTGAGGAAATCCTCGAGGATTTCCTCAAACTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks