EMAIL THIS PAGE TO A FRIEND

FABP1

fatty acid binding protein 1, liver

56 Gene Product Result for
Synonyms: FABPL L-FABP
UniProtKB ID: P07148
Gene ID:
Human(2168) Summary: This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]
Mouse(14080) fatty acid binding protein 1, liver
Rat(24360) fatty acid binding protein 1, liver
chicken(374015) fatty acid binding protein 1, liver
dog(403619) fatty acid binding protein 1, liver
cow(327700) fatty acid binding protein 1, liver
domestic cat(101095488) fatty acid binding protein 1, liver
naked mole-rat(101716348) fatty acid binding protein 1, liver
domestic guinea pig(100726384) fatty acid binding protein 1, liver
sheep(101108999) fatty acid binding protein 1, liver
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001443 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122491 MISSION® esiRNA esiRNA human FABP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001443 Rosetta Predictions human pricing
NM_012556 Rosetta Predictions rat pricing
NM_017399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167928 predicted 242
2 SASI_Hs01_00167930 predicted 200
3 SASI_Hs01_00167931 predicted 200
4 SASI_Hs01_00167929 predicted 204
5 SASI_Hs02_00331859 predicted 353
6 SASI_Hs02_00331860 predicted 94
7 SASI_Hs02_00331861 predicted 340
8 SASI_Hs02_00331862 predicted 403
9 SASI_Hs02_00331863 predicted 381
10 SASI_Hs02_00331864 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046406 predicted 192
2 SASI_Rn01_00046407 predicted 199
3 SASI_Rn01_00046408 predicted 208
4 SASI_Rn01_00046409 predicted 207
5 SASI_Rn01_00046410 predicted 204
6 SASI_Rn01_00046411 predicted 268
7 SASI_Rn01_00046412 predicted 233
8 SASI_Rn01_00046414 predicted 415
9 SASI_Rn01_00046415 predicted 356
10 SASI_Rn02_00259666 predicted 400
11 SASI_Rn01_00046413 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120757 predicted 202
2 SASI_Mm01_00120758 predicted 203
3 SASI_Mm01_00120759 predicted 202
4 SASI_Mm01_00120760 predicted 204
5 SASI_Mm01_00120761 predicted 203
6 SASI_Mm01_00120762 predicted 201
7 SASI_Mm01_00120763 predicted 233
8 SASI_Mm01_00120764 predicted 184
9 SASI_Mm01_00120765 predicted 354
10 SASI_Mm01_00120766 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017399
FABP1 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 1, liver
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-285s21c1
Sequence:CCGGCGTCAAGCTGGAAGGTGACAACTCGAGTTGTCACCTTCCAGCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-241s21c1
Sequence:CCGGGAGTGCGAACTGGAGACCATGCTCGAGCATGGTCTCCAGTTCGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-374s21c1
Sequence:CCGGCCATGACATTGGGCGACATTGCTCGAGCAATGTCGCCCAATGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-315s21c1
Sequence:CCGGGACAACTTTCAAAGGCATAAACTCGAGTTTATGCCTTTGAAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-151s1c1
Sequence:CCGGGTGTCAGAAATCGTGCATGAACTCGAGTTCATGCACGATTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-88s1c1
Sequence:CCGGCCATTCATGAAGGCAATAGGTCTCGAGACCTATTGCCTTCATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-190s1c1
Sequence:CCGGACCATCACCTATGGACCCAAACTCGAGTTTGGGTCCATAGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-72s1c1
Sequence:CCGGCCAGGAGAACTTTGAGCCATTCTCGAGAATGGCTCAAAGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-339s1c1
Sequence:CCGGCGTGACTGAACTCAATGGAGACTCGAGTCTCCATTGAGTTCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017399
FABP1 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 1, liver
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-285s21c1
Sequence:CCGGCGTCAAGCTGGAAGGTGACAACTCGAGTTGTCACCTTCCAGCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-241s21c1
Sequence:CCGGGAGTGCGAACTGGAGACCATGCTCGAGCATGGTCTCCAGTTCGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-374s21c1
Sequence:CCGGCCATGACATTGGGCGACATTGCTCGAGCAATGTCGCCCAATGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-315s21c1
Sequence:CCGGGACAACTTTCAAAGGCATAAACTCGAGTTTATGCCTTTGAAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-151s1c1
Sequence:CCGGGTGTCAGAAATCGTGCATGAACTCGAGTTCATGCACGATTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-88s1c1
Sequence:CCGGCCATTCATGAAGGCAATAGGTCTCGAGACCTATTGCCTTCATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-190s1c1
Sequence:CCGGACCATCACCTATGGACCCAAACTCGAGTTTGGGTCCATAGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-72s1c1
Sequence:CCGGCCAGGAGAACTTTGAGCCATTCTCGAGAATGGCTCAAAGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-339s1c1
Sequence:CCGGCGTGACTGAACTCAATGGAGACTCGAGTCTCCATTGAGTTCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017399
FABP1 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 1, liver
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-285s21c1
Sequence:CCGGCGTCAAGCTGGAAGGTGACAACTCGAGTTGTCACCTTCCAGCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-241s21c1
Sequence:CCGGGAGTGCGAACTGGAGACCATGCTCGAGCATGGTCTCCAGTTCGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-374s21c1
Sequence:CCGGCCATGACATTGGGCGACATTGCTCGAGCAATGTCGCCCAATGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017399.4-315s21c1
Sequence:CCGGGACAACTTTCAAAGGCATAAACTCGAGTTTATGCCTTTGAAAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-151s1c1
Sequence:CCGGGTGTCAGAAATCGTGCATGAACTCGAGTTCATGCACGATTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-88s1c1
Sequence:CCGGCCATTCATGAAGGCAATAGGTCTCGAGACCTATTGCCTTCATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-190s1c1
Sequence:CCGGACCATCACCTATGGACCCAAACTCGAGTTTGGGTCCATAGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-72s1c1
Sequence:CCGGCCAGGAGAACTTTGAGCCATTCTCGAGAATGGCTCAAAGTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017399.1-339s1c1
Sequence:CCGGCGTGACTGAACTCAATGGAGACTCGAGTCTCCATTGAGTTCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001443
FABP1 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 1, liver
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-383s21c1
Sequence:CCGGCATTGGGTGACATTGTCTTCACTCGAGTGAAGACAATGTCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-179s21c1
Sequence:CCGGAGCACTTCAAGTTCACCATCACTCGAGTGATGGTGAACTTGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-94s21c1
Sequence:CCGGTTCATGAAGGCAATCGGTCTGCTCGAGCAGACCGATTGCCTTCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-302s1c1
Sequence:CCGGGTGACAATAAACTGGTGACAACTCGAGTTGTCACCAGTTTATTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-154s1c1
Sequence:CCGGGTGTCGGAAATCGTGCAGAATCTCGAGATTCTGCACGATTTCCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-336s1c1
Sequence:CCGGCAAGTCTGTGACCGAACTCAACTCGAGTTGAGTTCGGTCACAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-271s1c1
Sequence:CCGGGAGAAAGTCAAGACAGTGGTTCTCGAGAACCACTGTCTTGACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-203s1c1
Sequence:CCGGCTGGGTCCAAAGTGATCCAAACTCGAGTTTGGATCACTTTGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001443
FABP1 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 1, liver
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-383s21c1
Sequence:CCGGCATTGGGTGACATTGTCTTCACTCGAGTGAAGACAATGTCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-179s21c1
Sequence:CCGGAGCACTTCAAGTTCACCATCACTCGAGTGATGGTGAACTTGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-94s21c1
Sequence:CCGGTTCATGAAGGCAATCGGTCTGCTCGAGCAGACCGATTGCCTTCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-302s1c1
Sequence:CCGGGTGACAATAAACTGGTGACAACTCGAGTTGTCACCAGTTTATTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-154s1c1
Sequence:CCGGGTGTCGGAAATCGTGCAGAATCTCGAGATTCTGCACGATTTCCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-336s1c1
Sequence:CCGGCAAGTCTGTGACCGAACTCAACTCGAGTTGAGTTCGGTCACAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-271s1c1
Sequence:CCGGGAGAAAGTCAAGACAGTGGTTCTCGAGAACCACTGTCTTGACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-203s1c1
Sequence:CCGGCTGGGTCCAAAGTGATCCAAACTCGAGTTTGGATCACTTTGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001443
FABP1 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 1, liver
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-383s21c1
Sequence:CCGGCATTGGGTGACATTGTCTTCACTCGAGTGAAGACAATGTCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-179s21c1
Sequence:CCGGAGCACTTCAAGTTCACCATCACTCGAGTGATGGTGAACTTGAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001443.1-94s21c1
Sequence:CCGGTTCATGAAGGCAATCGGTCTGCTCGAGCAGACCGATTGCCTTCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-302s1c1
Sequence:CCGGGTGACAATAAACTGGTGACAACTCGAGTTGTCACCAGTTTATTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-154s1c1
Sequence:CCGGGTGTCGGAAATCGTGCAGAATCTCGAGATTCTGCACGATTTCCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-336s1c1
Sequence:CCGGCAAGTCTGTGACCGAACTCAACTCGAGTTGAGTTCGGTCACAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-271s1c1
Sequence:CCGGGAGAAAGTCAAGACAGTGGTTCTCGAGAACCACTGTCTTGACTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001443.1-203s1c1
Sequence:CCGGCTGGGTCCAAAGTGATCCAAACTCGAGTTTGGATCACTTTGGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks