EMAIL THIS PAGE TO A FRIEND

FABP2

fatty acid binding protein 2, intestinal

97 Gene Product Result for
Synonyms: FABPI I-FABP
UniProtKB ID: P12104, Q2NKJ1
Gene ID:
Human(2169) Summary: The intracellular fatty acid-binding proteins (FABPs) belong to a multigene family with nearly twenty identified members. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Intestinal fatty acid-binding protein 2 gene contains four exons and is an abundant cytosolic protein in small intestine epithelial cells. This gene has a polymorphism at codon 54 that identified an alanine-encoding allele and a threonine-encoding allele. Thr-54 protein is associated with increased fat oxidation and insulin resistance. [provided by RefSeq, Jul 2008]
Mouse(14079) fatty acid binding protein 2, intestinal
Rat(25598) fatty acid binding protein 2, intestinal
Zebrafish(30708) fatty acid binding protein 2, intestinal
domestic cat(101093099) fatty acid binding protein 2, intestinal
cow(515768) fatty acid binding protein 2, intestinal
dog(487924) fatty acid binding protein 2, intestinal
chicken(422678) fatty acid binding protein 2, intestinal
domestic guinea pig(100727806) fatty acid binding protein 2, intestinal
sheep(101109799) fatty acid binding protein 2, intestinal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054151 MISSION® esiRNA esiRNA human FABP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000134 Rosetta Predictions human pricing
NM_013068 Rosetta Predictions rat pricing
NM_007980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221058 predicted 376
2 SASI_Hs01_00221059 predicted 492
3 SASI_Hs01_00221060 predicted 397
4 SASI_Hs01_00221061 predicted 346
5 SASI_Hs01_00221062 predicted 246
6 SASI_Hs01_00221063 predicted 387
7 SASI_Hs01_00221064 predicted 350
8 SASI_Hs01_00221065 predicted 399
9 SASI_Hs01_00221066 predicted 363
10 SASI_Hs01_00221067 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077950 predicted 329
2 SASI_Rn01_00077951 predicted 200
3 SASI_Rn02_00260815 predicted 311
4 SASI_Rn01_00077952 predicted 206
5 SASI_Rn01_00077953 predicted 327
6 SASI_Rn02_00260816 predicted 264
7 SASI_Rn01_00077954 predicted 205
8 SASI_Rn01_00077956 predicted 340
9 SASI_Rn01_00077957 predicted 310
10 SASI_Rn01_00077958 predicted 205
11 SASI_Rn01_00077955 predicted 306
12 SASI_Rn01_00077959 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024822 predicted 353
2 SASI_Mm01_00024823 predicted 262
3 SASI_Mm01_00024824 predicted 303
4 SASI_Mm01_00024827 predicted 287
5 SASI_Mm01_00024828 predicted 348
6 SASI_Mm02_00312884 predicted 365
7 SASI_Mm01_00024830 predicted 212
8 SASI_Mm01_00024831 predicted 379
9 SASI_Mm02_00312885 predicted 383
10 SASI_Mm02_00312886 predicted 341
11 SASI_Mm01_00024825 predicted 362
12 SASI_Mm01_00024826 predicted 277
13 SASI_Mm01_00024829 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000134
FABP2 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 2, intestinal
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000134.3-505s21c1
Sequence:CCGGCTATATTGTACCAGAACTATTCTCGAGAATAGTTCTGGTACAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000134.3-306s21c1
Sequence:CCGGTGGAGCCTTGAGGGAAATAAACTCGAGTTTATTTCCCTCAAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000134.3-899s21c1
Sequence:CCGGGCTAGGACTATGGGTACATTCCTCGAGGAATGTACCCATAGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-380s1c1
Sequence:CCGGCGAGAAATTATAGGTGATGAACTCGAGTTCATCACCTATAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-260s1c1
Sequence:CCGGGTCACCTTTAATTACAACCTACTCGAGTAGGTTGTAATTAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-404s1c1
Sequence:CCGGGTCCAGACTTATGTGTATGAACTCGAGTTCATACACATAAGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-163s1c1
Sequence:CCGGTGACAATTTGAAGCTGACAATCTCGAGATTGTCAGCTTCAAATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-347s1c1
Sequence:CCGGCGGACAGACAATGGAAACGAACTCGAGTTCGTTTCCATTGTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000134
FABP2 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 2, intestinal
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000134.3-505s21c1
Sequence:CCGGCTATATTGTACCAGAACTATTCTCGAGAATAGTTCTGGTACAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000134.3-306s21c1
Sequence:CCGGTGGAGCCTTGAGGGAAATAAACTCGAGTTTATTTCCCTCAAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000134.3-899s21c1
Sequence:CCGGGCTAGGACTATGGGTACATTCCTCGAGGAATGTACCCATAGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-380s1c1
Sequence:CCGGCGAGAAATTATAGGTGATGAACTCGAGTTCATCACCTATAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-260s1c1
Sequence:CCGGGTCACCTTTAATTACAACCTACTCGAGTAGGTTGTAATTAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-404s1c1
Sequence:CCGGGTCCAGACTTATGTGTATGAACTCGAGTTCATACACATAAGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-163s1c1
Sequence:CCGGTGACAATTTGAAGCTGACAATCTCGAGATTGTCAGCTTCAAATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-347s1c1
Sequence:CCGGCGGACAGACAATGGAAACGAACTCGAGTTCGTTTCCATTGTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000134
FABP2 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 2, intestinal
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000134.3-505s21c1
Sequence:CCGGCTATATTGTACCAGAACTATTCTCGAGAATAGTTCTGGTACAATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000134.3-306s21c1
Sequence:CCGGTGGAGCCTTGAGGGAAATAAACTCGAGTTTATTTCCCTCAAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000134.3-899s21c1
Sequence:CCGGGCTAGGACTATGGGTACATTCCTCGAGGAATGTACCCATAGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-380s1c1
Sequence:CCGGCGAGAAATTATAGGTGATGAACTCGAGTTCATCACCTATAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-260s1c1
Sequence:CCGGGTCACCTTTAATTACAACCTACTCGAGTAGGTTGTAATTAAAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-404s1c1
Sequence:CCGGGTCCAGACTTATGTGTATGAACTCGAGTTCATACACATAAGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-163s1c1
Sequence:CCGGTGACAATTTGAAGCTGACAATCTCGAGATTGTCAGCTTCAAATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000134.2-347s1c1
Sequence:CCGGCGGACAGACAATGGAAACGAACTCGAGTTCGTTTCCATTGTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007980
FABP2 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 2, intestinal
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007980.2-596s1c1
Sequence:CCGGGCTATACATGAACTAGTCTTTCTCGAGAAAGACTAGTTCATGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-399s1c1
Sequence:CCGGGCGATTCTTTAAGAAGGAATACTCGAGTATTCCTTCTTAAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-213s1c1
Sequence:CCGGGCTCGGTGTAAACTTTCCCTACTCGAGTAGGGAAAGTTTACACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-340s1c1
Sequence:CCGGCGAGAGGTTTCTGGTAATGAACTCGAGTTCATTACCAGAAACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-268s1c1
Sequence:CCGGTGGACCATTGAGGGAAATAAACTCGAGTTTATTTCCCTCAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007980
FABP2 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 2, intestinal
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007980.2-596s1c1
Sequence:CCGGGCTATACATGAACTAGTCTTTCTCGAGAAAGACTAGTTCATGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-399s1c1
Sequence:CCGGGCGATTCTTTAAGAAGGAATACTCGAGTATTCCTTCTTAAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-213s1c1
Sequence:CCGGGCTCGGTGTAAACTTTCCCTACTCGAGTAGGGAAAGTTTACACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-340s1c1
Sequence:CCGGCGAGAGGTTTCTGGTAATGAACTCGAGTTCATTACCAGAAACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-268s1c1
Sequence:CCGGTGGACCATTGAGGGAAATAAACTCGAGTTTATTTCCCTCAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007980
FABP2 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 2, intestinal
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007980.2-596s1c1
Sequence:CCGGGCTATACATGAACTAGTCTTTCTCGAGAAAGACTAGTTCATGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-399s1c1
Sequence:CCGGGCGATTCTTTAAGAAGGAATACTCGAGTATTCCTTCTTAAAGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-213s1c1
Sequence:CCGGGCTCGGTGTAAACTTTCCCTACTCGAGTAGGGAAAGTTTACACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-340s1c1
Sequence:CCGGCGAGAGGTTTCTGGTAATGAACTCGAGTTCATTACCAGAAACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007980.2-268s1c1
Sequence:CCGGTGGACCATTGAGGGAAATAAACTCGAGTTTATTTCCCTCAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks