EMAIL THIS PAGE TO A FRIEND

FABP3

fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)

79 Gene Product Result for
Synonyms: FABP11 H-FABP M-FABP MDGI O-FABP
UniProtKB ID: P05413, B2RAB6, Q5VV93, Q99957
Gene ID:
Human(2170) Summary: The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. [provided by RefSeq, Jul 2008]
Mouse(14077) fatty acid binding protein 3, muscle and heart
Rat(79131) fatty acid binding protein 3, muscle and heart
sheep(100913166) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
domestic guinea pig(100733606) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
naked mole-rat(101702075) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Zebrafish(171478) fatty acid binding protein 3, muscle and heart
cow(281758) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Horse(100033895) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
domestic cat(101093788) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
dog(478156) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
chicken(419557) fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100741 Anti-FABP3 (ab1) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rabbit, bovine, rat, horse, canine, pig, mouse
western blot pricing
SAB2100742 Anti-FABP3 (ab2) antibody produced in rabbit affinity isolated antibody human, rabbit, canine, horse, mouse, rat, guinea pig
immunohistochemistry, western blot pricing
SAB1405782 Anti-FABP3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108125 Anti-FABP3 antibody produced in rabbit affinity isolated antibody bovine, rabbit, guinea pig, rat, mouse, horse, human, pig, canine
immunohistochemistry, western blot pricing
AV33823 Anti-FABP3 antibody produced in rabbit IgG fraction of antiserum human, horse, rat, rabbit
immunohistochemistry, western blot pricing
HPA055754 Anti-FABP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1305512 MONOCLONAL ANTI-CARDIAC FABP antibody produced in mouse clone 388CT12.2.4.1, crude ascites, buffered aqueous solution mouse
western blot pricing
WH0002170M1 Monoclonal Anti-FABP3 antibody produced in mouse clone 4F6-1D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403803 Monoclonal Anti-FABP3 antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1305564 MONOCLONAL ANTI-FAPB3 antibody produced in mouse clone 883CT19.3.3, crude ascites, buffered aqueous solution mouse
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0657 Human FABP3 / Fatty Acid-binding Protein, Heart ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004102 Rosetta Predictions human pricing
NM_024162 Rosetta Predictions rat pricing
NM_010174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118866 predicted 229
2 SASI_Hs01_00118867 predicted 368
3 SASI_Hs01_00118868 predicted 321
4 SASI_Hs01_00118870 predicted 308
5 SASI_Hs01_00118871 predicted 372
6 SASI_Hs01_00118872 predicted 221
7 SASI_Hs02_00336917 predicted 327
8 SASI_Hs01_00118873 predicted 237
9 SASI_Hs01_00118874 predicted 839
10 SASI_Hs01_00118875 predicted 324
11 SASI_Hs01_00118869 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036923 predicted 377
2 SASI_Rn01_00036924 predicted 301
3 SASI_Rn01_00036925 predicted 344
4 SASI_Rn01_00036926 predicted 254
5 SASI_Rn01_00036927 predicted 253
6 SASI_Rn01_00036928 predicted 222
7 SASI_Rn01_00036929 predicted 366
8 SASI_Rn02_00263897 predicted 354
9 SASI_Rn01_00036930 predicted 296
10 SASI_Rn01_00036931 predicted 344
11 SASI_Rn01_00036932 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147190 predicted 343
2 SASI_Mm01_00147191 predicted 222
3 SASI_Mm01_00147192 predicted 256
4 SASI_Mm01_00147193 predicted 318
5 SASI_Mm01_00147194 predicted 336
6 SASI_Mm01_00147196 predicted 340
7 SASI_Mm01_00147197 predicted 265
8 SASI_Mm01_00147198 predicted 364
9 SASI_Mm02_00317960 predicted 315
10 SASI_Mm01_00147199 predicted 303
11 SASI_Mm01_00147195 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004102
FABP3 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-153s1c1
Sequence:CCGGGACCAAGCCTACCACAATCATCTCGAGATGATTGTGGTAGGCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-75s1c1
Sequence:CCGGGCTAGTGGACAGCAAGAATTTCTCGAGAAATTCTTGCTGTCCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-277s1c1
Sequence:CCGGGACAGGAAGGTCAAGTCCATTCTCGAGAATGGACTTGACCTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-92s21c1
Sequence:CCGGGCTAGTGGACAGCAAGAATTTCTCGAGAAATTCTTGCTGTCCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-168s21c1
Sequence:CCGGATGACCAAGCCTACCACAATCCTCGAGGATTGTGGTAGGCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-436s21c1
Sequence:CCGGGCACTCGCACTTATGAGAAAGCTCGAGCTTTCTCATAAGTGCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004102.3-658s21c1
Sequence:CCGGAGGGTGCTCTGAGGTCAATAACTCGAGTTATTGACCTCAGAGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-372s21c1
Sequence:CCGGACACTTGTGCGGGAGCTAATTCTCGAGAATTAGCTCCCGCACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004102
FABP3 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-153s1c1
Sequence:CCGGGACCAAGCCTACCACAATCATCTCGAGATGATTGTGGTAGGCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-75s1c1
Sequence:CCGGGCTAGTGGACAGCAAGAATTTCTCGAGAAATTCTTGCTGTCCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-277s1c1
Sequence:CCGGGACAGGAAGGTCAAGTCCATTCTCGAGAATGGACTTGACCTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-92s21c1
Sequence:CCGGGCTAGTGGACAGCAAGAATTTCTCGAGAAATTCTTGCTGTCCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-168s21c1
Sequence:CCGGATGACCAAGCCTACCACAATCCTCGAGGATTGTGGTAGGCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-436s21c1
Sequence:CCGGGCACTCGCACTTATGAGAAAGCTCGAGCTTTCTCATAAGTGCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004102.3-658s21c1
Sequence:CCGGAGGGTGCTCTGAGGTCAATAACTCGAGTTATTGACCTCAGAGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-372s21c1
Sequence:CCGGACACTTGTGCGGGAGCTAATTCTCGAGAATTAGCTCCCGCACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004102
FABP3 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-153s1c1
Sequence:CCGGGACCAAGCCTACCACAATCATCTCGAGATGATTGTGGTAGGCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-75s1c1
Sequence:CCGGGCTAGTGGACAGCAAGAATTTCTCGAGAAATTCTTGCTGTCCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004102.2-277s1c1
Sequence:CCGGGACAGGAAGGTCAAGTCCATTCTCGAGAATGGACTTGACCTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-92s21c1
Sequence:CCGGGCTAGTGGACAGCAAGAATTTCTCGAGAAATTCTTGCTGTCCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-168s21c1
Sequence:CCGGATGACCAAGCCTACCACAATCCTCGAGGATTGTGGTAGGCTTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-436s21c1
Sequence:CCGGGCACTCGCACTTATGAGAAAGCTCGAGCTTTCTCATAAGTGCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004102.3-658s21c1
Sequence:CCGGAGGGTGCTCTGAGGTCAATAACTCGAGTTATTGACCTCAGAGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004102.3-372s21c1
Sequence:CCGGACACTTGTGCGGGAGCTAATTCTCGAGAATTAGCTCCCGCACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010174
FABP3 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000455160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010174.1-265s21c1
Sequence:CCGGGGAGGCAAACTCATCCATGTGCTCGAGCACATGGATGAGTTTGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-114s1c1
Sequence:CCGGGCCTACTACCATCATCGAGAACTCGAGTTCTCGATGATGGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-159s1c1
Sequence:CCGGGACACAAAGTACCTTCAAGAACTCGAGTTCTTGAAGGTACTTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-340s1c1
Sequence:CCGGCTCATCCTGACTCTCACTCATCTCGAGATGAGTGAGAGTCAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-146s1c1
Sequence:CCGGCTATCACCATAAAGACACAAACTCGAGTTTGTGTCTTTATGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-55s1c1
Sequence:CCGGGACTACATGAAGTCACTCGGTCTCGAGACCGAGTGACTTCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010174
FABP3 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000455160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010174.1-265s21c1
Sequence:CCGGGGAGGCAAACTCATCCATGTGCTCGAGCACATGGATGAGTTTGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-114s1c1
Sequence:CCGGGCCTACTACCATCATCGAGAACTCGAGTTCTCGATGATGGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-159s1c1
Sequence:CCGGGACACAAAGTACCTTCAAGAACTCGAGTTCTTGAAGGTACTTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-340s1c1
Sequence:CCGGCTCATCCTGACTCTCACTCATCTCGAGATGAGTGAGAGTCAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-146s1c1
Sequence:CCGGCTATCACCATAAAGACACAAACTCGAGTTTGTGTCTTTATGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-55s1c1
Sequence:CCGGGACTACATGAAGTCACTCGGTCTCGAGACCGAGTGACTTCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010174
FABP3 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000455160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010174.1-265s21c1
Sequence:CCGGGGAGGCAAACTCATCCATGTGCTCGAGCACATGGATGAGTTTGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-114s1c1
Sequence:CCGGGCCTACTACCATCATCGAGAACTCGAGTTCTCGATGATGGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-159s1c1
Sequence:CCGGGACACAAAGTACCTTCAAGAACTCGAGTTCTTGAAGGTACTTTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-340s1c1
Sequence:CCGGCTCATCCTGACTCTCACTCATCTCGAGATGAGTGAGAGTCAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-146s1c1
Sequence:CCGGCTATCACCATAAAGACACAAACTCGAGTTTGTGTCTTTATGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010174.1-55s1c1
Sequence:CCGGGACTACATGAAGTCACTCGGTCTCGAGACCGAGTGACTTCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks