EMAIL THIS PAGE TO A FRIEND

FABP4

fatty acid binding protein 4, adipocyte

95 Gene Product Result for
Synonyms: A-FABP AFABP ALBP aP2
UniProtKB ID: P15090, Q6IBA1
Gene ID:
Human(2167) Summary: FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]
Mouse(11770) fatty acid binding protein 4, adipocyte
Rat(79451) fatty acid binding protein 4, adipocyte
chicken(374165) fatty acid binding protein 4, adipocyte
cow(281759) fatty acid binding protein 4, adipocyte
domestic cat(101087449) fatty acid binding protein 4, adipocyte
sheep(100137067) fatty acid binding protein 4, adipocyte
naked mole-rat(101706814) fatty acid binding protein 4, adipocyte
domestic guinea pig(100732353) fatty acid binding protein 4, adipocyte
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408988 Anti-FABP4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2108330 Anti-FABP4 antibody produced in rabbit affinity isolated antibody canine, human, rat, rabbit, mouse, rabbit, horse
western blot pricing
HPA002188 Anti-FABP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2100743 Anti-FABP4 antibody produced in rabbit affinity isolated antibody human, rat, horse, goat, mouse, canine, rabbit, sheep, rabbit
western blot pricing
SAB2104636 Anti-FABP4 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, human, rat, horse, canine, mouse, rabbit
western blot pricing
SAB4300636 Anti-FABP4 antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB1410359 Anti-FABP4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410360 Anti-FABP4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0002167M1 Monoclonal Anti-FABP4 antibody produced in mouse clone 2H3-1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403801 Monoclonal Anti-FABP4 antibody produced in mouse clone 4G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408986 Monoclonal Anti-FABP4 antibody produced in mouse clone 3G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1408987 Monoclonal Anti-FABP4 antibody produced in mouse clone 2F12-1B11, ascites fluid, solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019271 MISSION® esiRNA esiRNA targeting human FABP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001442 Rosetta Predictions human pricing
NM_053365 Rosetta Predictions rat pricing
XM_579554 Rosetta Predictions rat pricing
NM_024406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331850 predicted 604
2 SASI_Hs02_00331851 predicted 521
3 SASI_Hs02_00331852 predicted 469
4 SASI_Hs02_00331853 predicted 449
5 SASI_Hs02_00331854 predicted 429
6 SASI_Hs02_00331855 predicted 204
7 SASI_Hs02_00331856 predicted 478
8 SASI_Hs02_00331857 predicted 499
9 SASI_Hs01_00098694 predicted 302
10 SASI_Hs02_00331858 predicted 420
11 SASI_Hs01_00098687 predicted 254
12 SASI_Hs01_00098688 predicted 388
13 SASI_Hs01_00098689 predicted 252
14 SASI_Hs01_00098690 predicted 374
15 SASI_Hs01_00098691 predicted 238
16 SASI_Hs01_00098692 predicted 289
17 SASI_Hs01_00098693 predicted 288
18 SASI_Hs01_00098695 predicted 328
19 SASI_Hs01_00098696 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038767 predicted 467
2 SASI_Rn02_00265842 predicted 340
3 SASI_Rn02_00265843 predicted 147
4 SASI_Rn01_00038770 predicted 407
5 SASI_Rn01_00038771 predicted 466
6 SASI_Rn01_00038772 predicted 194
7 SASI_Rn01_00038773 predicted 167
8 SASI_Rn01_00038775 predicted 87
9 SASI_Rn02_00265844 predicted 84
10 SASI_Rn02_00265845 predicted 393
11 SASI_Rn01_00038768 predicted 203
12 SASI_Rn01_00038769 predicted 469
13 SASI_Rn01_00038774 predicted 173
14 SASI_Rn01_00038776 predicted 137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182074 predicted 242
2 SASI_Rn01_00182075 predicted 219
3 SASI_Rn01_00182076 predicted 264
4 SASI_Rn01_00182077 predicted 256
5 SASI_Rn01_00182078 predicted 259
6 SASI_Rn01_00182079 predicted 206
7 SASI_Rn01_00182080 predicted 220
8 SASI_Rn01_00182081 predicted 213
9 SASI_Rn01_00182082 predicted 210
10 SASI_Rn01_00182083 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327719 predicted 208
2 SASI_Mm02_00327720 predicted 208
3 SASI_Mm01_00132113 predicted 257
4 SASI_Mm01_00132114 predicted 240
5 SASI_Mm01_00132116 predicted 294
6 SASI_Mm02_00327721 predicted 211
7 SASI_Mm02_00327722 predicted 209
8 SASI_Mm01_00132117 predicted 255
9 SASI_Mm01_00132118 predicted 243
10 SASI_Mm01_00132119 predicted 294
11 SASI_Mm01_00132112 predicted 282
12 SASI_Mm01_00132115 predicted 270
13 SASI_Mm01_00132120 predicted 245
14 SASI_Mm01_00132121 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001442
FABP4 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 4, adipocyte
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001442.2-562s21c1
Sequence:CCGGGATTTAGCAAGCAACTAATTTCTCGAGAAATTAGTTGCTTGCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001442.2-412s21c1
Sequence:CCGGTGGTGGTGGAATGCGTCATGACTCGAGTCATGACGCATTCCACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001442.2-501s21c1
Sequence:CCGGGCATTGAACTCTACAACATTCCTCGAGGAATGTTGTAGAGTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-413s1c1
Sequence:CCGGCGTCACTTCCACGAGAGTTTACTCGAGTAAACTCTCGTGGAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-424s1c1
Sequence:CCGGCGAGAGTTTATGAGAGAGCATCTCGAGATGCTCTCTCATAAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-250s1c1
Sequence:CCGGGCCAGGAATTTGACGAAGTCACTCGAGTGACTTCGTCAAATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-329s1c1
Sequence:CCGGTGTGCAGAAATGGGATGGAAACTCGAGTTTCCATCCCATTTCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-192s1c1
Sequence:CCGGGTGATCACCATTAAATCTGAACTCGAGTTCAGATTTAATGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001442
FABP4 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 4, adipocyte
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001442.2-562s21c1
Sequence:CCGGGATTTAGCAAGCAACTAATTTCTCGAGAAATTAGTTGCTTGCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001442.2-412s21c1
Sequence:CCGGTGGTGGTGGAATGCGTCATGACTCGAGTCATGACGCATTCCACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001442.2-501s21c1
Sequence:CCGGGCATTGAACTCTACAACATTCCTCGAGGAATGTTGTAGAGTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-413s1c1
Sequence:CCGGCGTCACTTCCACGAGAGTTTACTCGAGTAAACTCTCGTGGAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-424s1c1
Sequence:CCGGCGAGAGTTTATGAGAGAGCATCTCGAGATGCTCTCTCATAAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-250s1c1
Sequence:CCGGGCCAGGAATTTGACGAAGTCACTCGAGTGACTTCGTCAAATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-329s1c1
Sequence:CCGGTGTGCAGAAATGGGATGGAAACTCGAGTTTCCATCCCATTTCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-192s1c1
Sequence:CCGGGTGATCACCATTAAATCTGAACTCGAGTTCAGATTTAATGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001442
FABP4 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 4, adipocyte
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001442.2-562s21c1
Sequence:CCGGGATTTAGCAAGCAACTAATTTCTCGAGAAATTAGTTGCTTGCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001442.2-412s21c1
Sequence:CCGGTGGTGGTGGAATGCGTCATGACTCGAGTCATGACGCATTCCACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001442.2-501s21c1
Sequence:CCGGGCATTGAACTCTACAACATTCCTCGAGGAATGTTGTAGAGTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-413s1c1
Sequence:CCGGCGTCACTTCCACGAGAGTTTACTCGAGTAAACTCTCGTGGAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-424s1c1
Sequence:CCGGCGAGAGTTTATGAGAGAGCATCTCGAGATGCTCTCTCATAAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-250s1c1
Sequence:CCGGGCCAGGAATTTGACGAAGTCACTCGAGTGACTTCGTCAAATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-329s1c1
Sequence:CCGGTGTGCAGAAATGGGATGGAAACTCGAGTTTCCATCCCATTTCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001442.1-192s1c1
Sequence:CCGGGTGATCACCATTAAATCTGAACTCGAGTTCAGATTTAATGGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024406
VALIDATED
FABP4 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 4, adipocyte
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-180s21c1
Sequence:CCGGCCCAACATGATCATCAGCGTACTCGAGTACGCTGATGATCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-418s21c1
Sequence:CCGGGTGTTATGAAAGGCGTGACTTCTCGAGAAGTCACGCCTTTCATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024406.2-480s21c1
Sequence:CCGGCTGGATGGAAATTTGCATCAACTCGAGTTGATGCAAATTTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-431s21c1
Sequence:CCGGCGTGACTTCCACAAGAGTTTACTCGAGTAAACTCTTGTGGAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-458s1c1
Sequence:CCGGCTGGATGGAAATTTGCATCAACTCGAGTTGATGCAAATTTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-158s1c1
Sequence:CCGGCCCAACATGATCATCAGCGTACTCGAGTACGCTGATGATCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-396s1c1
Sequence:CCGGGTGTTATGAAAGGCGTGACTTCTCGAGAAGTCACGCCTTTCATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024406.1-278s1c1
Sequence:CCGGAGGAAGGTGAAGAGCATCATACTCGAGTATGATGCTCTTCACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-409s1c1
Sequence:CCGGCGTGACTTCCACAAGAGTTTACTCGAGTAAACTCTTGTGGAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024406
VALIDATED
FABP4 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 4, adipocyte
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-180s21c1
Sequence:CCGGCCCAACATGATCATCAGCGTACTCGAGTACGCTGATGATCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-418s21c1
Sequence:CCGGGTGTTATGAAAGGCGTGACTTCTCGAGAAGTCACGCCTTTCATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024406.2-480s21c1
Sequence:CCGGCTGGATGGAAATTTGCATCAACTCGAGTTGATGCAAATTTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-431s21c1
Sequence:CCGGCGTGACTTCCACAAGAGTTTACTCGAGTAAACTCTTGTGGAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-458s1c1
Sequence:CCGGCTGGATGGAAATTTGCATCAACTCGAGTTGATGCAAATTTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-158s1c1
Sequence:CCGGCCCAACATGATCATCAGCGTACTCGAGTACGCTGATGATCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-396s1c1
Sequence:CCGGGTGTTATGAAAGGCGTGACTTCTCGAGAAGTCACGCCTTTCATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024406.1-278s1c1
Sequence:CCGGAGGAAGGTGAAGAGCATCATACTCGAGTATGATGCTCTTCACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-409s1c1
Sequence:CCGGCGTGACTTCCACAAGAGTTTACTCGAGTAAACTCTTGTGGAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024406
VALIDATED
FABP4 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 4, adipocyte
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-180s21c1
Sequence:CCGGCCCAACATGATCATCAGCGTACTCGAGTACGCTGATGATCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-418s21c1
Sequence:CCGGGTGTTATGAAAGGCGTGACTTCTCGAGAAGTCACGCCTTTCATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024406.2-480s21c1
Sequence:CCGGCTGGATGGAAATTTGCATCAACTCGAGTTGATGCAAATTTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024406.2-431s21c1
Sequence:CCGGCGTGACTTCCACAAGAGTTTACTCGAGTAAACTCTTGTGGAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-458s1c1
Sequence:CCGGCTGGATGGAAATTTGCATCAACTCGAGTTGATGCAAATTTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-158s1c1
Sequence:CCGGCCCAACATGATCATCAGCGTACTCGAGTACGCTGATGATCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-396s1c1
Sequence:CCGGGTGTTATGAAAGGCGTGACTTCTCGAGAAGTCACGCCTTTCATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024406.1-278s1c1
Sequence:CCGGAGGAAGGTGAAGAGCATCATACTCGAGTATGATGCTCTTCACCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024406.1-409s1c1
Sequence:CCGGCGTGACTTCCACAAGAGTTTACTCGAGTAAACTCTTGTGGAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks