EMAIL THIS PAGE TO A FRIEND

FABP5

fatty acid binding protein 5 (psoriasis-associated)

49 Gene Product Result for
Synonyms: E-FABP EFABP KFABP PA-FABP PAFABP
UniProtKB ID: Q01469, B2R4K0
Gene ID:
Human(2171) Summary: This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011]
Mouse(16592) fatty acid binding protein 5, epidermal
Rat(140868) fatty acid binding protein 5, epidermal
domestic guinea pig(100337640) fatty acid binding protein 5, epidermal
naked mole-rat(101707906) fatty acid binding protein 5 (psoriasis-associated)
sheep(100270712) fatty acid binding protein 5 (psoriasis-associated)
chicken(420197) fatty acid binding protein 5 (psoriasis-associated)
cow(281760) fatty acid binding protein 5 (psoriasis-associated)
dog(609554) cationic amino acid transporter 3-like
domestic cat(101086698) fatty acid binding protein 5 (psoriasis-associated)
dog(477923) fatty acid binding protein 5 (psoriasis-associated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1445 Human FABP5 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093911 MISSION® esiRNA esiRNA targeting mouse Fabp5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001444 Rosetta Predictions human pricing
NM_145878 Rosetta Predictions rat pricing
NM_010634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331865 predicted 245
2 SASI_Hs02_00331866 predicted 618
3 SASI_Hs02_00331867 predicted 629
4 SASI_Hs01_00027896 predicted 173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084915 predicted 211
2 SASI_Rn01_00084916 predicted 408
3 SASI_Rn01_00084917 predicted 407
4 SASI_Rn02_00268804 predicted 436
5 SASI_Rn02_00268805 predicted 433
6 SASI_Rn01_00084918 predicted 388
7 SASI_Rn02_00268806 predicted 394
8 SASI_Rn02_00268807 predicted 343
9 SASI_Rn01_00084920 predicted 279
10 SASI_Rn02_00268808 predicted 346
11 SASI_Rn01_00084919 predicted 432
12 SASI_Rn01_00084921 predicted 270
13 SASI_Rn01_00084922 predicted 333
14 SASI_Rn01_00084923 predicted 240
15 SASI_Rn01_00084924 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146163 predicted 670
2 SASI_Mm01_00146164 predicted 650
3 SASI_Mm01_00146165 predicted 650
4 SASI_Mm01_00146166 predicted 643
5 SASI_Mm01_00146168 predicted 691
6 SASI_Mm01_00146170 predicted 692
7 SASI_Mm02_00318981 predicted 591
8 SASI_Mm01_00146169 predicted 241
9 SASI_Mm02_00318982 predicted 584
10 SASI_Mm02_00318983 predicted 585
11 SASI_Mm01_00146167 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001444
FABP5 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 5 (psoriasis-associated)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-176s1c1
Sequence:CCGGGTATCATCACTTGTGATGGTACTCGAGTACCATCACAAGTGATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-106s1c1
Sequence:CCGGGATGAATACATGAAGGAGCTACTCGAGTAGCTCCTTCATGTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-308s1c1
Sequence:CCGGGCAACTTTACAGATGGTGCATCTCGAGATGCACCATCTGTAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-253s1c1
Sequence:CCGGCTGGGAGAGAAGTTTGAAGAACTCGAGTTCTTCAAACTTCTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-349s1c1
Sequence:CCGGGATGGGAAGGAAAGCACAATACTCGAGTATTGTGCTTTCCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001444.1-471s21c1
Sequence:CCGGCTTTGGACAGGAGTTAATTAACTCGAGTTAATTAACTCCTGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001444.1-515s21c1
Sequence:CCGGTGAGCAAATCTCCATACTGTTCTCGAGAACAGTATGGAGATTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001444.1-378s21c1
Sequence:CCGGATTGAAAGATGGGAAATTAGTCTCGAGACTAATTTCCCATCTTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001444.1-400s21c1
Sequence:CCGGGTGGAGTGTGTCATGAACAATCTCGAGATTGTTCATGACACACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001444
FABP5 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 5 (psoriasis-associated)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-176s1c1
Sequence:CCGGGTATCATCACTTGTGATGGTACTCGAGTACCATCACAAGTGATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-106s1c1
Sequence:CCGGGATGAATACATGAAGGAGCTACTCGAGTAGCTCCTTCATGTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-308s1c1
Sequence:CCGGGCAACTTTACAGATGGTGCATCTCGAGATGCACCATCTGTAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-253s1c1
Sequence:CCGGCTGGGAGAGAAGTTTGAAGAACTCGAGTTCTTCAAACTTCTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-349s1c1
Sequence:CCGGGATGGGAAGGAAAGCACAATACTCGAGTATTGTGCTTTCCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001444.1-471s21c1
Sequence:CCGGCTTTGGACAGGAGTTAATTAACTCGAGTTAATTAACTCCTGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001444.1-515s21c1
Sequence:CCGGTGAGCAAATCTCCATACTGTTCTCGAGAACAGTATGGAGATTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001444.1-378s21c1
Sequence:CCGGATTGAAAGATGGGAAATTAGTCTCGAGACTAATTTCCCATCTTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001444.1-400s21c1
Sequence:CCGGGTGGAGTGTGTCATGAACAATCTCGAGATTGTTCATGACACACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001444
FABP5 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 5 (psoriasis-associated)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-176s1c1
Sequence:CCGGGTATCATCACTTGTGATGGTACTCGAGTACCATCACAAGTGATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-106s1c1
Sequence:CCGGGATGAATACATGAAGGAGCTACTCGAGTAGCTCCTTCATGTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-308s1c1
Sequence:CCGGGCAACTTTACAGATGGTGCATCTCGAGATGCACCATCTGTAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-253s1c1
Sequence:CCGGCTGGGAGAGAAGTTTGAAGAACTCGAGTTCTTCAAACTTCTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001444.1-349s1c1
Sequence:CCGGGATGGGAAGGAAAGCACAATACTCGAGTATTGTGCTTTCCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001444.1-471s21c1
Sequence:CCGGCTTTGGACAGGAGTTAATTAACTCGAGTTAATTAACTCCTGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001444.1-515s21c1
Sequence:CCGGTGAGCAAATCTCCATACTGTTCTCGAGAACAGTATGGAGATTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001444.1-378s21c1
Sequence:CCGGATTGAAAGATGGGAAATTAGTCTCGAGACTAATTTCCCATCTTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001444.1-400s21c1
Sequence:CCGGGTGGAGTGTGTCATGAACAATCTCGAGATTGTTCATGACACACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010634
VALIDATED
FABP5 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 5 (psoriasis-associated)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-419s1c1
Sequence:CCGGCGGGTCTATGAGAAGGTGCAACTCGAGTTGCACCTTCTCATAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-92s1c1
Sequence:CCGGGAGGAGTACATGAAAGAGCTACTCGAGTAGCTCTTTCATGTACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-166s1c1
Sequence:CCGGCATTACGTGTGATGGCAACAACTCGAGTTGTTGCCATCACACGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010634.1-149s1c1
Sequence:CCGGGCCAAGCCAGACTGTATCATTCTCGAGAATGATACAGTCTGGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010634.1-592s1c1
Sequence:CCGGCTTCATGTCAAACTTGGTTTACTCGAGTAAACCAAGTTTGACATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-178s21c1
Sequence:CCGGTGGCAACAACATCACGGTCAACTCGAGTTGACCGTGATGTTGTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010634.2-749s21c1
Sequence:CCGGGATCCCTTATGACTGATATATCTCGAGATATATCAGTCATAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-112s21c1
Sequence:CCGGAGGAGTAGGACTGGCTCTTAGCTCGAGCTAAGAGCCAGTCCTACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-218s21c1
Sequence:CCGGACGACTGTGTTCTCTTGTAACCTCGAGGTTACAAGAGAACACAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-336s21c1
Sequence:CCGGACGGGAAGGAGAGCACGATAACTCGAGTTATCGTGCTCTCCTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010634
VALIDATED
FABP5 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 5 (psoriasis-associated)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-419s1c1
Sequence:CCGGCGGGTCTATGAGAAGGTGCAACTCGAGTTGCACCTTCTCATAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-92s1c1
Sequence:CCGGGAGGAGTACATGAAAGAGCTACTCGAGTAGCTCTTTCATGTACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-166s1c1
Sequence:CCGGCATTACGTGTGATGGCAACAACTCGAGTTGTTGCCATCACACGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010634.1-149s1c1
Sequence:CCGGGCCAAGCCAGACTGTATCATTCTCGAGAATGATACAGTCTGGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010634.1-592s1c1
Sequence:CCGGCTTCATGTCAAACTTGGTTTACTCGAGTAAACCAAGTTTGACATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-178s21c1
Sequence:CCGGTGGCAACAACATCACGGTCAACTCGAGTTGACCGTGATGTTGTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010634.2-749s21c1
Sequence:CCGGGATCCCTTATGACTGATATATCTCGAGATATATCAGTCATAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-112s21c1
Sequence:CCGGAGGAGTAGGACTGGCTCTTAGCTCGAGCTAAGAGCCAGTCCTACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-218s21c1
Sequence:CCGGACGACTGTGTTCTCTTGTAACCTCGAGGTTACAAGAGAACACAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-336s21c1
Sequence:CCGGACGGGAAGGAGAGCACGATAACTCGAGTTATCGTGCTCTCCTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010634
VALIDATED
FABP5 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 5 (psoriasis-associated)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-419s1c1
Sequence:CCGGCGGGTCTATGAGAAGGTGCAACTCGAGTTGCACCTTCTCATAGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-92s1c1
Sequence:CCGGGAGGAGTACATGAAAGAGCTACTCGAGTAGCTCTTTCATGTACTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010634.1-166s1c1
Sequence:CCGGCATTACGTGTGATGGCAACAACTCGAGTTGTTGCCATCACACGTAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010634.1-149s1c1
Sequence:CCGGGCCAAGCCAGACTGTATCATTCTCGAGAATGATACAGTCTGGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010634.1-592s1c1
Sequence:CCGGCTTCATGTCAAACTTGGTTTACTCGAGTAAACCAAGTTTGACATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-178s21c1
Sequence:CCGGTGGCAACAACATCACGGTCAACTCGAGTTGACCGTGATGTTGTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010634.2-749s21c1
Sequence:CCGGGATCCCTTATGACTGATATATCTCGAGATATATCAGTCATAAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-112s21c1
Sequence:CCGGAGGAGTAGGACTGGCTCTTAGCTCGAGCTAAGAGCCAGTCCTACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-218s21c1
Sequence:CCGGACGACTGTGTTCTCTTGTAACCTCGAGGTTACAAGAGAACACAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010634.2-336s21c1
Sequence:CCGGACGGGAAGGAGAGCACGATAACTCGAGTTATCGTGCTCTCCTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks