EMAIL THIS PAGE TO A FRIEND

FABP6

fatty acid binding protein 6, ileal

63 Gene Product Result for
Synonyms: I-15P I-BABP I-BALB I-BAP ILBP ILBP3 ILLBP
UniProtKB ID: P51161, Q07DR7, Q8TBI3, Q9UGI7
Gene ID:
Human(2172) Summary: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16204) fatty acid binding protein 6, ileal (gastrotropin)
Rat(25440) fatty acid binding protein 6, ileal
Zebrafish(415166) fatty acid binding protein 6, ileal (gastrotropin)
dog(479309) fatty acid binding protein 6, ileal
domestic cat(101082978) fatty acid binding protein 6, ileal
cow(514650) fatty acid binding protein 6, ileal
chicken(416154) fatty acid binding protein 6, ileal
sheep(101116051) fatty acid binding protein 6, ileal
naked mole-rat(101725952) fatty acid binding protein 6, ileal
domestic guinea pig(100712938) fatty acid binding protein 6, ileal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1446 Human FABP6 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100931 MISSION® esiRNA esiRNA human FABP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040442 Rosetta Predictions human pricing
NM_001445 Rosetta Predictions human pricing
NM_017098 Rosetta Predictions rat pricing
NM_008375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156528 predicted 214
2 SASI_Hs01_00156529 predicted 299
3 SASI_Hs01_00156531 predicted 274
4 SASI_Hs01_00156532 predicted 247
5 SASI_Hs01_00156533 predicted 202
6 SASI_Hs01_00156534 predicted 248
7 SASI_Hs01_00156535 predicted 210
8 SASI_Hs01_00156536 predicted 409
9 SASI_Hs02_00308980 predicted 318
10 SASI_Hs02_00308981 predicted 282
11 SASI_Hs01_00156527 predicted 396
12 SASI_Hs01_00156530 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075275 predicted 222
2 SASI_Hs01_00075276 predicted 313
3 SASI_Hs01_00075278 predicted 245
4 SASI_Hs01_00075279 predicted 319
5 SASI_Hs01_00075280 predicted 232
6 SASI_Hs01_00075281 predicted 308
7 SASI_Hs01_00075282 predicted 218
8 SASI_Hs01_00075283 predicted 354
9 SASI_Hs02_00331868 predicted 247
10 SASI_Hs02_00331869 predicted 315
11 SASI_Hs01_00075274 predicted 313
12 SASI_Hs01_00075277 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081995 predicted 237
2 SASI_Rn01_00081996 predicted 214
3 SASI_Rn01_00081997 predicted 240
4 SASI_Rn01_00081999 predicted 241
5 SASI_Rn01_00082000 predicted 235
6 SASI_Rn01_00082001 predicted 273
7 SASI_Rn01_00082002 predicted 216
8 SASI_Rn01_00082003 predicted 225
9 SASI_Rn01_00082004 predicted 219
10 SASI_Rn02_00261319 predicted 234
11 SASI_Rn01_00081998 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188119 predicted 90
2 SASI_Mm01_00188120 predicted 63
3 SASI_Mm02_00313738 predicted 64
4 SASI_Mm01_00188122 predicted 292
5 SASI_Mm01_00188123 predicted 34
6 SASI_Mm01_00188124 predicted 180
7 SASI_Mm01_00188125 predicted 194
8 SASI_Mm01_00188126 predicted 30
9 SASI_Mm01_00188127 predicted 347
10 SASI_Mm02_00313739 predicted 10
11 SASI_Mm01_00188121 predicted 253
12 SASI_Mm01_00188128 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001445
FABP6 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 6, ileal
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-486s21c1
Sequence:CCGGTATGAGCGCGTGAGCAAGAGACTCGAGTCTCTTGCTCACGCGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-167s21c1
Sequence:CCGGGAATTATGATGAGTTCATGAACTCGAGTTCATGAACTCATCATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-333s21c1
Sequence:CCGGGAAAGCAACATACAGACAATGCTCGAGCATTGTCTGTATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-256s21c1
Sequence:CCGGAGGATGGGCAGGACTTCACTTCTCGAGAAGTGAAGTCCTGCCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-311s1c1
Sequence:CCGGCAACAAGTTCACTGTTGGCAACTCGAGTTGCCAACAGTGAACTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-227s1c1
Sequence:CCGGCAACTTCAAGATCGTCACGGACTCGAGTCCGTGACGATCTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-199s1c1
Sequence:CCGGTCTCCAGCGATGTAATCGAAACTCGAGTTTCGATTACATCGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-419s1c1
Sequence:CCGGCTATCACCAGACCTCAGAGATCTCGAGATCTCTGAGGTCTGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-156s1c1
Sequence:CCGGGAGAGTGAGAAGAATTATGATCTCGAGATCATAATTCTTCTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001445
FABP6 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 6, ileal
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-486s21c1
Sequence:CCGGTATGAGCGCGTGAGCAAGAGACTCGAGTCTCTTGCTCACGCGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-167s21c1
Sequence:CCGGGAATTATGATGAGTTCATGAACTCGAGTTCATGAACTCATCATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-333s21c1
Sequence:CCGGGAAAGCAACATACAGACAATGCTCGAGCATTGTCTGTATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-256s21c1
Sequence:CCGGAGGATGGGCAGGACTTCACTTCTCGAGAAGTGAAGTCCTGCCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-311s1c1
Sequence:CCGGCAACAAGTTCACTGTTGGCAACTCGAGTTGCCAACAGTGAACTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-227s1c1
Sequence:CCGGCAACTTCAAGATCGTCACGGACTCGAGTCCGTGACGATCTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-199s1c1
Sequence:CCGGTCTCCAGCGATGTAATCGAAACTCGAGTTTCGATTACATCGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-419s1c1
Sequence:CCGGCTATCACCAGACCTCAGAGATCTCGAGATCTCTGAGGTCTGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-156s1c1
Sequence:CCGGGAGAGTGAGAAGAATTATGATCTCGAGATCATAATTCTTCTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001445
FABP6 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 6, ileal
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-486s21c1
Sequence:CCGGTATGAGCGCGTGAGCAAGAGACTCGAGTCTCTTGCTCACGCGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-167s21c1
Sequence:CCGGGAATTATGATGAGTTCATGAACTCGAGTTCATGAACTCATCATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-333s21c1
Sequence:CCGGGAAAGCAACATACAGACAATGCTCGAGCATTGTCTGTATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001445.2-256s21c1
Sequence:CCGGAGGATGGGCAGGACTTCACTTCTCGAGAAGTGAAGTCCTGCCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-311s1c1
Sequence:CCGGCAACAAGTTCACTGTTGGCAACTCGAGTTGCCAACAGTGAACTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-227s1c1
Sequence:CCGGCAACTTCAAGATCGTCACGGACTCGAGTCCGTGACGATCTTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-199s1c1
Sequence:CCGGTCTCCAGCGATGTAATCGAAACTCGAGTTTCGATTACATCGCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-419s1c1
Sequence:CCGGCTATCACCAGACCTCAGAGATCTCGAGATCTCTGAGGTCTGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001445.1-156s1c1
Sequence:CCGGGAGAGTGAGAAGAATTATGATCTCGAGATCATAATTCTTCTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008375
FABP6 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 6, ileal
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-194s1c1
Sequence:CCGGCCATTGGCAAAGAATGTGAAACTCGAGTTTCACATTCTTTGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-195s1c1
Sequence:CCGGCATTGGCAAAGAATGTGAAATCTCGAGATTTCACATTCTTTGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-36s1c1
Sequence:CCGGGAAGAATTACGATGAGTTCATCTCGAGATGAACTCATCGTAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-171s1c1
Sequence:CCGGCAACATTATGAGCAACAAGTTCTCGAGAACTTGTTGCTCATAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-200s1c1
Sequence:CCGGGCAAAGAATGTGAAATGCAGACTCGAGTCTGCATTTCACATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008375
FABP6 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 6, ileal
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-194s1c1
Sequence:CCGGCCATTGGCAAAGAATGTGAAACTCGAGTTTCACATTCTTTGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-195s1c1
Sequence:CCGGCATTGGCAAAGAATGTGAAATCTCGAGATTTCACATTCTTTGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-36s1c1
Sequence:CCGGGAAGAATTACGATGAGTTCATCTCGAGATGAACTCATCGTAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-171s1c1
Sequence:CCGGCAACATTATGAGCAACAAGTTCTCGAGAACTTGTTGCTCATAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-200s1c1
Sequence:CCGGGCAAAGAATGTGAAATGCAGACTCGAGTCTGCATTTCACATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008375
FABP6 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 6, ileal
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-194s1c1
Sequence:CCGGCCATTGGCAAAGAATGTGAAACTCGAGTTTCACATTCTTTGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-195s1c1
Sequence:CCGGCATTGGCAAAGAATGTGAAATCTCGAGATTTCACATTCTTTGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-36s1c1
Sequence:CCGGGAAGAATTACGATGAGTTCATCTCGAGATGAACTCATCGTAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-171s1c1
Sequence:CCGGCAACATTATGAGCAACAAGTTCTCGAGAACTTGTTGCTCATAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008375.1-200s1c1
Sequence:CCGGGCAAAGAATGTGAAATGCAGACTCGAGTCTGCATTTCACATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks