EMAIL THIS PAGE TO A FRIEND

FABP7

fatty acid binding protein 7, brain

59 Gene Product Result for
Synonyms: B-FABP BLBP FABPB MRG
UniProtKB ID: O15540, B2R4L1, O14951, Q6IAU7
Gene ID:
Human(2173) Summary: The protein encoded by this gene is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs are thought to play roles in fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]
Mouse(12140) fatty acid binding protein 7, brain
Rat(80841) fatty acid binding protein 7, brain
domestic guinea pig(100730597) fatty acid binding protein 7, brain
naked mole-rat(101722020) fatty acid binding protein 7, brain
sheep(101120755) fatty acid binding protein 7, brain
chicken(396246) fatty acid binding protein 7, brain
cow(777787) fatty acid binding protein 7, brain
domestic cat(101080289) fatty acid binding protein 7, brain
dog(476278) fatty acid binding protein 7, brain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101096 Anti-FABP7 (11-23) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1405785 Anti-FABP7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1408991 Anti-FABP7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV33827 Anti-FABP7 antibody produced in rabbit IgG fraction of antiserum bovine, rat, guinea pig, canine, horse, pig, human, mouse, rabbit
western blot pricing
PRS4259 Anti-FABP7 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
HPA028825 Anti-FABP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410364 Anti-FABP7 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410365 Anti-FABP7 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90595 Monoclonal Anti-FABP7 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0236, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001446 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004421 MISSION® esiRNA esiRNA targeting mouse Fabp7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001446 Rosetta Predictions human pricing
NM_030832 Rosetta Predictions rat pricing
NM_021272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088068 predicted 574
2 SASI_Hs01_00088069 predicted 358
3 SASI_Hs01_00088070 predicted 516
4 SASI_Hs01_00088071 predicted 398
5 SASI_Hs01_00088072 predicted 323
6 SASI_Hs01_00088075 predicted 426
7 SASI_Hs01_00088076 predicted 406
8 SASI_Hs02_00331870 predicted 581
9 SASI_Hs01_00088077 predicted 505
10 SASI_Hs02_00331871 predicted 400
11 SASI_Hs01_00088073 predicted 419
12 SASI_Hs01_00088074 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090200 predicted 319
2 SASI_Rn02_00264048 predicted 322
3 SASI_Rn01_00090202 predicted 377
4 SASI_Rn01_00090204 predicted 346
5 SASI_Rn02_00264049 predicted 271
6 SASI_Rn01_00090205 predicted 221
7 SASI_Rn01_00090206 predicted 315
8 SASI_Rn01_00090209 predicted 234
9 SASI_Rn02_00264050 predicted 368
10 SASI_Rn02_00264051 predicted 229
11 SASI_Rn01_00090201 predicted 207
12 SASI_Rn01_00090203 predicted 267
13 SASI_Rn01_00090207 predicted 279
14 SASI_Rn01_00090208 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040732 predicted 327
2 SASI_Mm01_00040733 predicted 411
3 SASI_Mm01_00040734 predicted 326
4 SASI_Mm01_00040735 predicted 381
5 SASI_Mm01_00040736 predicted 380
6 SASI_Mm01_00040737 predicted 212
7 SASI_Mm02_00325793 predicted 372
8 SASI_Mm01_00040739 predicted 197
9 SASI_Mm02_00325794 predicted 367
10 SASI_Mm01_00040740 predicted 236
11 SASI_Mm01_00040738 predicted 354
12 SASI_Mm01_00040741 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021272
VALIDATED
FABP7 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 7, brain
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-353s1c1
Sequence:CCGGGATGGAGACAAGCTCATTCATCTCGAGATGAATGAGCTTGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-613s1c1
Sequence:CCGGGATGTGTTACTCCAAGCAATTCTCGAGAATTGCTTGGAGTAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-199s1c1
Sequence:CCGGGACCAAACCAACTGTGATTATCTCGAGATAATCACAGTTGGTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021272.2-408s1c1
Sequence:CCGGCCAGAGAAATTAAGGATGGCACTCGAGTGCCATCCTTAATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-247s1c1
Sequence:CCGGCCGGACACAATGCACATTCAACTCGAGTTGAATGTGCATTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-378s21c1
Sequence:CCGGTGGGATGGCAAAGAAACAAATCTCGAGATTTGTTTCTTTGCCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021272.3-545s21c1
Sequence:CCGGTGAAGCACTGGTCACTAATTACTCGAGTAATTAGTGACCAGTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-483s21c1
Sequence:CCGGTAGAAGAGATGACAGGACTTTCTCGAGAAAGTCCTGTCATCTCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-451s21c1
Sequence:CCGGATATCGTTGCTGTTCGCTGTTCTCGAGAACAGCGAACAGCAACGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-428s21c1
Sequence:CCGGGGTCGTGACTCTTACCTTTGGCTCGAGCCAAAGGTAAGAGTCACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021272
VALIDATED
FABP7 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 7, brain
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-353s1c1
Sequence:CCGGGATGGAGACAAGCTCATTCATCTCGAGATGAATGAGCTTGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-613s1c1
Sequence:CCGGGATGTGTTACTCCAAGCAATTCTCGAGAATTGCTTGGAGTAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-199s1c1
Sequence:CCGGGACCAAACCAACTGTGATTATCTCGAGATAATCACAGTTGGTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021272.2-408s1c1
Sequence:CCGGCCAGAGAAATTAAGGATGGCACTCGAGTGCCATCCTTAATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-247s1c1
Sequence:CCGGCCGGACACAATGCACATTCAACTCGAGTTGAATGTGCATTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-378s21c1
Sequence:CCGGTGGGATGGCAAAGAAACAAATCTCGAGATTTGTTTCTTTGCCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021272.3-545s21c1
Sequence:CCGGTGAAGCACTGGTCACTAATTACTCGAGTAATTAGTGACCAGTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-483s21c1
Sequence:CCGGTAGAAGAGATGACAGGACTTTCTCGAGAAAGTCCTGTCATCTCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-451s21c1
Sequence:CCGGATATCGTTGCTGTTCGCTGTTCTCGAGAACAGCGAACAGCAACGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-428s21c1
Sequence:CCGGGGTCGTGACTCTTACCTTTGGCTCGAGCCAAAGGTAAGAGTCACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021272
VALIDATED
FABP7 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 7, brain
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-353s1c1
Sequence:CCGGGATGGAGACAAGCTCATTCATCTCGAGATGAATGAGCTTGTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-613s1c1
Sequence:CCGGGATGTGTTACTCCAAGCAATTCTCGAGAATTGCTTGGAGTAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-199s1c1
Sequence:CCGGGACCAAACCAACTGTGATTATCTCGAGATAATCACAGTTGGTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021272.2-408s1c1
Sequence:CCGGCCAGAGAAATTAAGGATGGCACTCGAGTGCCATCCTTAATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021272.2-247s1c1
Sequence:CCGGCCGGACACAATGCACATTCAACTCGAGTTGAATGTGCATTGTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-378s21c1
Sequence:CCGGTGGGATGGCAAAGAAACAAATCTCGAGATTTGTTTCTTTGCCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021272.3-545s21c1
Sequence:CCGGTGAAGCACTGGTCACTAATTACTCGAGTAATTAGTGACCAGTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-483s21c1
Sequence:CCGGTAGAAGAGATGACAGGACTTTCTCGAGAAAGTCCTGTCATCTCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-451s21c1
Sequence:CCGGATATCGTTGCTGTTCGCTGTTCTCGAGAACAGCGAACAGCAACGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021272.3-428s21c1
Sequence:CCGGGGTCGTGACTCTTACCTTTGGCTCGAGCCAAAGGTAAGAGTCACGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001446
FABP7 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 7, brain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-324s1c1
Sequence:CCGGGCTGACCAACAGTCAGAACTTCTCGAGAAGTTCTGACTGTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-576s1c1
Sequence:CCGGCATACAGAAATGGGATGGCAACTCGAGTTGCCATCCCATTTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-400s1c1
Sequence:CCGGGTGACCAAACCAACGGTAATTCTCGAGAATTACCGTTGGTTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-346s1c1
Sequence:CCGGGATGAGTACATGAAGGCTCTACTCGAGTAGAGCCTTCATGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-530s1c1
Sequence:CCGGGAAACTGTAAGTCTGTTGTTACTCGAGTAACAACAGACTTACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001446.3-663s21c1
Sequence:CCGGGGTTGCTGTTCGCCACTATGACTCGAGTCATAGTGGCGAACAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001446.3-841s21c1
Sequence:CCGGTCCAAGCAACTTGCCCAATTTCTCGAGAAATTGGGCAAGTTGCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001446.3-766s21c1
Sequence:CCGGACAACATGGCTGATCATTAATCTCGAGATTAATGATCAGCCATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001446.3-422s21c1
Sequence:CCGGTCAGTCAAGAAGGAGACAAAGCTCGAGCTTTGTCTCCTTCTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001446
FABP7 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 7, brain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-324s1c1
Sequence:CCGGGCTGACCAACAGTCAGAACTTCTCGAGAAGTTCTGACTGTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-576s1c1
Sequence:CCGGCATACAGAAATGGGATGGCAACTCGAGTTGCCATCCCATTTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-400s1c1
Sequence:CCGGGTGACCAAACCAACGGTAATTCTCGAGAATTACCGTTGGTTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-346s1c1
Sequence:CCGGGATGAGTACATGAAGGCTCTACTCGAGTAGAGCCTTCATGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-530s1c1
Sequence:CCGGGAAACTGTAAGTCTGTTGTTACTCGAGTAACAACAGACTTACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001446.3-663s21c1
Sequence:CCGGGGTTGCTGTTCGCCACTATGACTCGAGTCATAGTGGCGAACAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001446.3-841s21c1
Sequence:CCGGTCCAAGCAACTTGCCCAATTTCTCGAGAAATTGGGCAAGTTGCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001446.3-766s21c1
Sequence:CCGGACAACATGGCTGATCATTAATCTCGAGATTAATGATCAGCCATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001446.3-422s21c1
Sequence:CCGGTCAGTCAAGAAGGAGACAAAGCTCGAGCTTTGTCTCCTTCTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001446
FABP7 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 7, brain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-324s1c1
Sequence:CCGGGCTGACCAACAGTCAGAACTTCTCGAGAAGTTCTGACTGTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-576s1c1
Sequence:CCGGCATACAGAAATGGGATGGCAACTCGAGTTGCCATCCCATTTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-400s1c1
Sequence:CCGGGTGACCAAACCAACGGTAATTCTCGAGAATTACCGTTGGTTTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-346s1c1
Sequence:CCGGGATGAGTACATGAAGGCTCTACTCGAGTAGAGCCTTCATGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001446.3-530s1c1
Sequence:CCGGGAAACTGTAAGTCTGTTGTTACTCGAGTAACAACAGACTTACAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001446.3-663s21c1
Sequence:CCGGGGTTGCTGTTCGCCACTATGACTCGAGTCATAGTGGCGAACAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001446.3-841s21c1
Sequence:CCGGTCCAAGCAACTTGCCCAATTTCTCGAGAAATTGGGCAAGTTGCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001446.3-766s21c1
Sequence:CCGGACAACATGGCTGATCATTAATCTCGAGATTAATGATCAGCCATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001446.3-422s21c1
Sequence:CCGGTCAGTCAAGAAGGAGACAAAGCTCGAGCTTTGTCTCCTTCTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks