EMAIL THIS PAGE TO A FRIEND

FABP9

fatty acid binding protein 9, testis

38 Gene Product Result for
Synonyms: PERF PERF15 T-FABP
UniProtKB ID: Q0Z7S8
Gene ID:
Mouse(21884) fatty acid binding protein 9, testis
Rat(64822) fatty acid binding protein 9, testis
cow(515385) fatty acid binding protein 9, testis
domestic cat(101087200) fatty acid binding protein 9, testis
dog(487016) fatty acid binding protein 9, testis
sheep(101113339) fatty acid binding protein 9, testis
naked mole-rat(101707176) fatty acid binding protein 9, testis
domestic guinea pig(100724164) fatty acid binding protein 9, testis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080526 Rosetta Predictions human pricing
NM_022854 Rosetta Predictions rat pricing
NM_011598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315697 predicted 269
2 SASI_Hs02_00315698 predicted 104
3 SASI_Hs02_00315699 predicted 113
4 SASI_Hs02_00315700 predicted 224
5 SASI_Hs02_00315701 predicted 263
6 SASI_Hs02_00315702 predicted 240
7 SASI_Hs02_00315703 predicted 151
8 SASI_Hs02_00315704 predicted 96
9 SASI_Hs02_00315705 predicted 106
10 SASI_Hs02_00315706 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060431 predicted 199
2 SASI_Rn01_00060432 predicted 206
3 SASI_Rn01_00060433 predicted 214
4 SASI_Rn02_00263568 predicted 273
5 SASI_Rn01_00060434 predicted 263
6 SASI_Rn01_00060435 predicted 308
7 SASI_Rn01_00060436 predicted 329
8 SASI_Rn01_00060437 predicted 301
9 SASI_Rn01_00060438 predicted 301
10 SASI_Rn01_00060439 predicted 253
11 SASI_Rn01_00060440 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118152 predicted 313
2 SASI_Mm01_00118153 predicted 326
3 SASI_Mm01_00118154 predicted 224
4 SASI_Mm01_00118155 predicted 325
5 SASI_Mm01_00118156 predicted 307
6 SASI_Mm01_00118157 predicted 308
7 SASI_Mm01_00118158 predicted 235
8 SASI_Mm02_00321013 predicted 321
9 SASI_Mm01_00118159 predicted 237
10 SASI_Mm01_00118160 predicted 307
11 SASI_Mm01_00118161 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080526
FABP9 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 9, testis
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-203s21c1
Sequence:CCGGGGGAAGAATTTGATGAAACTACTCGAGTAGTTTCATCAAATTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-225s21c1
Sequence:CCGGAGCAGACAACCGGAAAGTAAACTCGAGTTTACTTTCCGGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-109s21c1
Sequence:CCGGGTGAAACCGACAGTAACTATTCTCGAGAATAGTTACTGTCGGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-166s21c1
Sequence:CCGGAGTTCTTTCCAGGACACTAAGCTCGAGCTTAGTGTCCTGGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-63s21c1
Sequence:CCGGGAAAGAACTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080526
FABP9 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 9, testis
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-203s21c1
Sequence:CCGGGGGAAGAATTTGATGAAACTACTCGAGTAGTTTCATCAAATTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-225s21c1
Sequence:CCGGAGCAGACAACCGGAAAGTAAACTCGAGTTTACTTTCCGGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-109s21c1
Sequence:CCGGGTGAAACCGACAGTAACTATTCTCGAGAATAGTTACTGTCGGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-166s21c1
Sequence:CCGGAGTTCTTTCCAGGACACTAAGCTCGAGCTTAGTGTCCTGGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-63s21c1
Sequence:CCGGGAAAGAACTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080526
FABP9 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 9, testis
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-203s21c1
Sequence:CCGGGGGAAGAATTTGATGAAACTACTCGAGTAGTTTCATCAAATTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-225s21c1
Sequence:CCGGAGCAGACAACCGGAAAGTAAACTCGAGTTTACTTTCCGGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-109s21c1
Sequence:CCGGGTGAAACCGACAGTAACTATTCTCGAGAATAGTTACTGTCGGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-166s21c1
Sequence:CCGGAGTTCTTTCCAGGACACTAAGCTCGAGCTTAGTGTCCTGGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080526.1-63s21c1
Sequence:CCGGGAAAGAACTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011598
FABP9 MISSION shRNA Bacterial Glycerol Stock
fatty acid binding protein 9, testis
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-147s1c1
Sequence:CCGGCCCGGAAAGTCGCATGTTTAACTCGAGTTAAACATGCGACTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-171s1c1
Sequence:CCGGAGCCAAGCGTTAGTATTAGTTCTCGAGAACTAATACTAACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-238s1c1
Sequence:CCGGCACGGAGATCTCTTTCAAGTTCTCGAGAACTTGAAAGAGATCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-172s1c1
Sequence:CCGGGCCAAGCGTTAGTATTAGTTTCTCGAGAAACTAATACTAACGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-352s1c1
Sequence:CCGGGCTTGGCAAACAGACAACAATCTCGAGATTGTTGTCTGTTTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011598
FABP9 MISSION shRNA shRNA Plasmid DNA
fatty acid binding protein 9, testis
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-147s1c1
Sequence:CCGGCCCGGAAAGTCGCATGTTTAACTCGAGTTAAACATGCGACTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-171s1c1
Sequence:CCGGAGCCAAGCGTTAGTATTAGTTCTCGAGAACTAATACTAACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-238s1c1
Sequence:CCGGCACGGAGATCTCTTTCAAGTTCTCGAGAACTTGAAAGAGATCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-172s1c1
Sequence:CCGGGCCAAGCGTTAGTATTAGTTTCTCGAGAAACTAATACTAACGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-352s1c1
Sequence:CCGGGCTTGGCAAACAGACAACAATCTCGAGATTGTTGTCTGTTTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011598
FABP9 MISSION shRNA Lentiviral Transduction Particles
fatty acid binding protein 9, testis
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-147s1c1
Sequence:CCGGCCCGGAAAGTCGCATGTTTAACTCGAGTTAAACATGCGACTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-171s1c1
Sequence:CCGGAGCCAAGCGTTAGTATTAGTTCTCGAGAACTAATACTAACGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-238s1c1
Sequence:CCGGCACGGAGATCTCTTTCAAGTTCTCGAGAACTTGAAAGAGATCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-172s1c1
Sequence:CCGGGCCAAGCGTTAGTATTAGTTTCTCGAGAAACTAATACTAACGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011598.2-352s1c1
Sequence:CCGGGCTTGGCAAACAGACAACAATCTCGAGATTGTTGTCTGTTTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks