EMAIL THIS PAGE TO A FRIEND

FADD

Fas (TNFRSF6)-associated via death domain

Synonyms: MORT1
UniProtKB ID: Q13158, Q14866, Q6IBR4
Gene ID:
Human(8772) Summary: The protein encoded by this gene is an adaptor molecule that interacts with various cell surface receptors and mediates cell apoptotic signals. Through its C-terminal death domain, this protein can be recruited by TNFRSF6/Fas-receptor, tumor necrosis factor receptor, TNFRSF25, and TNFSF10/TRAIL-receptor, and thus it participates in the death signaling initiated by these receptors. Interaction of this protein with the receptors unmasks the N-terminal effector domain of this protein, which allows it to recruit caspase-8, and thereby activate the cysteine protease cascade. Knockout studies in mice also suggest the importance of this protein in early T cell development. [provided by RefSeq, Jul 2008]
Mouse(14082) Fas (TNFRSF6)-associated via death domain
Rat(266610) Fas (TNFRSF6)-associated via death domain
Zebrafish(562317) Fas (tnfrsf6)-associated via death domain
chicken(423146) Fas (TNFRSF6)-associated via death domain
dog(611694) Fas (TNFRSF6)-associated via death domain
cow(493720) Fas (TNFRSF6)-associated via death domain
domestic guinea pig(100730628) Fas (TNFRSF6)-associated via death domain
naked mole-rat(101709972) Fas (TNFRSF6)-associated via death domain
sheep(101116783) Fas (TNFRSF6)-associated via death domain
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV01012 Anti-FADD (AB1) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV30294 Anti-FADD (AB2) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
HPA001464 Anti-FADD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503471 Anti-FADD antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
F8053 Anti-FADD antibody, Mouse monoclonal clone FD19, purified from hybridoma cell culture human
ELISA, immunoprecipitation, microarray, western blot pricing
SAB4503470 Anti-FADD, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1304733 ANTI-MOUSE FADD (CENTER S191) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1303559 ANTI-MOUSE PHOSPHO-FADD-S191 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB4504752 Anti-phospho-FADD (pSer191) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301377 Anti-phospho-FADD (pSer191) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4503868 Anti-phospho-FADD (pSer194) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0008772M1 Monoclonal Anti-FADD antibody produced in mouse clone 3A12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100257 Monoclonal Anti-FADD antibody produced in mouse clone FADD-A226, culture supernatant human
western blot pricing
SAB1404623 Monoclonal Anti-FADD, (C-terminal) antibody produced in mouse clone 3C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003824 siRNAs that have been validated in the lab human pricing
NM_152937 Rosetta Predictions rat pricing
NM_010175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003824 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150128 validated 1057
2 SASI_Hs01_00150129 predicted 900
3 SASI_Hs01_00150131 predicted 1055
4 SASI_Hs01_00150133 predicted 1064
5 SASI_Hs01_00150134 predicted 916
6 SASI_Hs01_00150135 predicted 1033
7 SASI_Hs01_00150136 predicted 874
8 SASI_Hs02_00336372 predicted 1028
9 SASI_Hs01_00150132 predicted 964
10 SASI_Hs02_00336373 predicted 301
11 SASI_Hs01_00150130 predicted 956
12 SASI_Hs01_00150137 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268925 predicted 389
2 SASI_Rn02_00268926 predicted 376
3 SASI_Rn02_00268927 predicted 321
4 SASI_Rn01_00091671 predicted 317
5 SASI_Rn02_00268928 predicted 454
6 SASI_Rn02_00268929 predicted 402
7 SASI_Rn02_00268930 predicted 339
8 SASI_Rn02_00268931 predicted 331
9 SASI_Rn02_00268932 predicted 466
10 SASI_Rn02_00268933 predicted 377
11 SASI_Rn01_00091670 predicted 367
12 SASI_Rn01_00091672 predicted 618
13 SASI_Rn01_00091673 predicted 654
14 SASI_Rn01_00091674 predicted 612
15 SASI_Rn01_00091675 predicted 508
16 SASI_Rn01_00091676 predicted 1013
17 SASI_Rn01_00091677 predicted 118
18 SASI_Rn01_00091678 predicted 1029
19 SASI_Rn01_00091679 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317961 predicted 928
2 SASI_Mm01_00026024 predicted 1136
3 SASI_Mm01_00026025 predicted 92
4 SASI_Mm01_00026026 predicted 929
5 SASI_Mm01_00026027 predicted 992
6 SASI_Mm01_00026028 predicted 456
7 SASI_Mm01_00026029 predicted 1013
8 SASI_Mm01_00026030 predicted 1104
9 SASI_Mm01_00026031 predicted 45
10 SASI_Mm01_00026032 predicted 459
11 SASI_Mm01_00026033 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003824
VALIDATED
FADD MISSION shRNA Bacterial Glycerol Stock
Fas (TNFRSF6)-associated via death domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003824.2-580s1c2
Sequence:CCGGGAAGACCTGTGTGCAGCATTTCTCGAGAAATGCTGCACACAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-590s1c1
Sequence:CCGGGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-887s1c1
Sequence:CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-817s1c1
Sequence:CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-580s1c1
Sequence:CCGGGAAGACCTGTGTGCAGCATTTCTCGAGAAATGCTGCACACAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003824.2-663s1c1
Sequence:CCGGAGACACCAAGATCGACAGCATCTCGAGATGCTGTCGATCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-887s21c1
Sequence:CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-817s21c1
Sequence:CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-590s21c1
Sequence:CCGGGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-1058s21c1
Sequence:CCGGTGAACTCAAGCTGCGTTTATTCTCGAGAATAAACGCAGCTTGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003824
VALIDATED
FADD MISSION shRNA shRNA Plasmid DNA
Fas (TNFRSF6)-associated via death domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003824.2-580s1c2
Sequence:CCGGGAAGACCTGTGTGCAGCATTTCTCGAGAAATGCTGCACACAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-590s1c1
Sequence:CCGGGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-887s1c1
Sequence:CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-817s1c1
Sequence:CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-580s1c1
Sequence:CCGGGAAGACCTGTGTGCAGCATTTCTCGAGAAATGCTGCACACAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003824.2-663s1c1
Sequence:CCGGAGACACCAAGATCGACAGCATCTCGAGATGCTGTCGATCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-887s21c1
Sequence:CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-817s21c1
Sequence:CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-590s21c1
Sequence:CCGGGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-1058s21c1
Sequence:CCGGTGAACTCAAGCTGCGTTTATTCTCGAGAATAAACGCAGCTTGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003824
VALIDATED
FADD MISSION shRNA Lentiviral Transduction Particles
Fas (TNFRSF6)-associated via death domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003824.2-580s1c2
Sequence:CCGGGAAGACCTGTGTGCAGCATTTCTCGAGAAATGCTGCACACAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-590s1c1
Sequence:CCGGGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-887s1c1
Sequence:CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-817s1c1
Sequence:CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003824.2-580s1c1
Sequence:CCGGGAAGACCTGTGTGCAGCATTTCTCGAGAAATGCTGCACACAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003824.2-663s1c1
Sequence:CCGGAGACACCAAGATCGACAGCATCTCGAGATGCTGTCGATCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-887s21c1
Sequence:CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-817s21c1
Sequence:CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-590s21c1
Sequence:CCGGGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003824.3-1058s21c1
Sequence:CCGGTGAACTCAAGCTGCGTTTATTCTCGAGAATAAACGCAGCTTGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010175
VALIDATED
FADD MISSION shRNA Bacterial Glycerol Stock
Fas (TNFRSF6)-associated via death domain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-1463s1c1
Sequence:CCGGCCACACTTGGAGCCCAATAAACTCGAGTTTATTGGGCTCCAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-587s1c1
Sequence:CCGGCCCAGGAATCTGTGAGCAAGACTCGAGTCTTGCTCACAGATTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-99s1c1
Sequence:CCGGCAACGATCTGATGGAGCTCAACTCGAGTTGAGCTCCATCAGATCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-486s1c1
Sequence:CCGGAGTCTGGAAGAATGCTGAGAACTCGAGTTCTCAGCATTCTTCCAGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-132s1c1
Sequence:CCGGCGAGCGCGTGAGCAAACGAAACTCGAGTTTCGTTTGCTCACGCGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-98s21c1
Sequence:CCGGCAACGATCTGATGGAGCTCAACTCGAGTTGAGCTCCATCAGATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-586s21c1
Sequence:CCGGCCCAGGAATCTGTGAGCAAGACTCGAGTCTTGCTCACAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-485s21c1
Sequence:CCGGAGTCTGGAAGAATGCTGAGAACTCGAGTTCTCAGCATTCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010175.5-1462s21c1
Sequence:CCGGCCACACTTGGAGCCCAATAAACTCGAGTTTATTGGGCTCCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010175
VALIDATED
FADD MISSION shRNA shRNA Plasmid DNA
Fas (TNFRSF6)-associated via death domain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-1463s1c1
Sequence:CCGGCCACACTTGGAGCCCAATAAACTCGAGTTTATTGGGCTCCAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-587s1c1
Sequence:CCGGCCCAGGAATCTGTGAGCAAGACTCGAGTCTTGCTCACAGATTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-99s1c1
Sequence:CCGGCAACGATCTGATGGAGCTCAACTCGAGTTGAGCTCCATCAGATCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-486s1c1
Sequence:CCGGAGTCTGGAAGAATGCTGAGAACTCGAGTTCTCAGCATTCTTCCAGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-132s1c1
Sequence:CCGGCGAGCGCGTGAGCAAACGAAACTCGAGTTTCGTTTGCTCACGCGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-98s21c1
Sequence:CCGGCAACGATCTGATGGAGCTCAACTCGAGTTGAGCTCCATCAGATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-586s21c1
Sequence:CCGGCCCAGGAATCTGTGAGCAAGACTCGAGTCTTGCTCACAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-485s21c1
Sequence:CCGGAGTCTGGAAGAATGCTGAGAACTCGAGTTCTCAGCATTCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010175.5-1462s21c1
Sequence:CCGGCCACACTTGGAGCCCAATAAACTCGAGTTTATTGGGCTCCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010175
VALIDATED
FADD MISSION shRNA Lentiviral Transduction Particles
Fas (TNFRSF6)-associated via death domain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-1463s1c1
Sequence:CCGGCCACACTTGGAGCCCAATAAACTCGAGTTTATTGGGCTCCAAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-587s1c1
Sequence:CCGGCCCAGGAATCTGTGAGCAAGACTCGAGTCTTGCTCACAGATTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-99s1c1
Sequence:CCGGCAACGATCTGATGGAGCTCAACTCGAGTTGAGCTCCATCAGATCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-486s1c1
Sequence:CCGGAGTCTGGAAGAATGCTGAGAACTCGAGTTCTCAGCATTCTTCCAGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010175.2-132s1c1
Sequence:CCGGCGAGCGCGTGAGCAAACGAAACTCGAGTTTCGTTTGCTCACGCGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-98s21c1
Sequence:CCGGCAACGATCTGATGGAGCTCAACTCGAGTTGAGCTCCATCAGATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-586s21c1
Sequence:CCGGCCCAGGAATCTGTGAGCAAGACTCGAGTCTTGCTCACAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010175.5-485s21c1
Sequence:CCGGAGTCTGGAAGAATGCTGAGAACTCGAGTTCTCAGCATTCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010175.5-1462s21c1
Sequence:CCGGCCACACTTGGAGCCCAATAAACTCGAGTTTATTGGGCTCCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks