EMAIL THIS PAGE TO A FRIEND

FADS1

fatty acid desaturase 1

Synonyms: D5D FADS6 FADSD5 LLCDL1 TU12
Gene ID:
Human(3992) Summary: The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
Mouse(76267) fatty acid desaturase 1
Rat(84575) fatty acid desaturase 1
sheep(101109049) fatty acid desaturase 1
naked mole-rat(101698014) fatty acid desaturase 1
domestic guinea pig(100723348) fatty acid desaturase 1
chicken(423120) fatty acid desaturase 1
cow(533107) fatty acid desaturase 1
Horse(100062635) fatty acid desaturase 1
domestic cat(101083966) fatty acid desaturase 1
dog(483793) fatty acid desaturase 1
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013402 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013402 Rosetta Predictions human pricing
NM_053445 Rosetta Predictions rat pricing
NM_146094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189208 predicted 1389
2 SASI_Hs01_00189209 predicted 1350
3 SASI_Hs01_00189210 predicted 847
4 SASI_Hs01_00189211 predicted 1484
5 SASI_Hs01_00189212 predicted 1479
6 SASI_Hs01_00189214 predicted 900
7 SASI_Hs01_00189215 predicted 1223
8 SASI_Hs01_00189216 predicted 526
9 SASI_Hs01_00189217 predicted 844
10 SASI_Hs02_00344785 predicted 767
11 SASI_Hs01_00189213 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048535 predicted 977
2 SASI_Rn01_00048536 predicted 1119
3 SASI_Rn01_00048538 predicted 1302
4 SASI_Rn02_00266021 predicted 320
5 SASI_Rn01_00048539 predicted 654
6 SASI_Rn01_00048540 predicted 1521
7 SASI_Rn01_00048541 predicted 659
8 SASI_Rn01_00048542 predicted 1508
9 SASI_Rn01_00048544 predicted 387
10 SASI_Rn02_00266022 predicted 320
11 SASI_Rn01_00048537 predicted 1514
12 SASI_Rn01_00048543 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132429 predicted 874
2 SASI_Mm01_00132430 predicted 1360
3 SASI_Mm01_00132431 predicted 395
4 SASI_Mm01_00132432 predicted 545
5 SASI_Mm01_00132433 predicted 319
6 SASI_Mm01_00132434 predicted 915
7 SASI_Mm01_00132435 predicted 317
8 SASI_Mm01_00132436 predicted 1308
9 SASI_Mm01_00132438 predicted 1387
10 SASI_Mm02_00341733 predicted 375
11 SASI_Mm01_00132437 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146094
VALIDATED
FADS1 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146094.1-914s21c1
Sequence:CCGGCCTCTATACTTCCAGTGGTATCTCGAGATACCACTGGAAGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146094.1-1492s21c1
Sequence:CCGGGCCACTATGAATCTAATGTTTCTCGAGAAACATTAGATTCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146094.1-1318s21c1
Sequence:CCGGCGGCATCAAGTATGAGTCCAACTCGAGTTGGACTCATACTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-1492s1c1
Sequence:CCGGGCCACTATGAATCTAATGTTTCTCGAGAAACATTAGATTCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-914s1c1
Sequence:CCGGCCTCTATACTTCCAGTGGTATCTCGAGATACCACTGGAAGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-913s1c1
Sequence:CCGGGCCTCTATACTTCCAGTGGTACTCGAGTACCACTGGAAGTATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-534s1c1
Sequence:CCGGCCCTTTGGATCTTTGGAACTTCTCGAGAAGTTCCAAAGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-1318s1c1
Sequence:CCGGCGGCATCAAGTATGAGTCCAACTCGAGTTGGACTCATACTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146094
VALIDATED
FADS1 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146094.1-914s21c1
Sequence:CCGGCCTCTATACTTCCAGTGGTATCTCGAGATACCACTGGAAGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146094.1-1492s21c1
Sequence:CCGGGCCACTATGAATCTAATGTTTCTCGAGAAACATTAGATTCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146094.1-1318s21c1
Sequence:CCGGCGGCATCAAGTATGAGTCCAACTCGAGTTGGACTCATACTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-1492s1c1
Sequence:CCGGGCCACTATGAATCTAATGTTTCTCGAGAAACATTAGATTCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-914s1c1
Sequence:CCGGCCTCTATACTTCCAGTGGTATCTCGAGATACCACTGGAAGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-913s1c1
Sequence:CCGGGCCTCTATACTTCCAGTGGTACTCGAGTACCACTGGAAGTATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-534s1c1
Sequence:CCGGCCCTTTGGATCTTTGGAACTTCTCGAGAAGTTCCAAAGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-1318s1c1
Sequence:CCGGCGGCATCAAGTATGAGTCCAACTCGAGTTGGACTCATACTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146094
VALIDATED
FADS1 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146094.1-914s21c1
Sequence:CCGGCCTCTATACTTCCAGTGGTATCTCGAGATACCACTGGAAGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146094.1-1492s21c1
Sequence:CCGGGCCACTATGAATCTAATGTTTCTCGAGAAACATTAGATTCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146094.1-1318s21c1
Sequence:CCGGCGGCATCAAGTATGAGTCCAACTCGAGTTGGACTCATACTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-1492s1c1
Sequence:CCGGGCCACTATGAATCTAATGTTTCTCGAGAAACATTAGATTCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-914s1c1
Sequence:CCGGCCTCTATACTTCCAGTGGTATCTCGAGATACCACTGGAAGTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-913s1c1
Sequence:CCGGGCCTCTATACTTCCAGTGGTACTCGAGTACCACTGGAAGTATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-534s1c1
Sequence:CCGGCCCTTTGGATCTTTGGAACTTCTCGAGAAGTTCCAAAGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146094.1-1318s1c1
Sequence:CCGGCGGCATCAAGTATGAGTCCAACTCGAGTTGGACTCATACTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013402
VALIDATED
FADS1 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1570s21c1
Sequence:CCGGCCGACATCATCCACTCACTAACTCGAGTTAGTGAGTGGATGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1001s21c1
Sequence:CCGGGCATCCCTTCTTCTTTGCCTTCTCGAGAAGGCAAAGAAGAAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1473s21c1
Sequence:CCGGCCTCGACACAATTACCACAAACTCGAGTTTGTGGTAATTGTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1209s21c1
Sequence:CCGGGTCCGCTTCTTCCTCACTTATCTCGAGATAAGTGAGGAAGAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-536s21c1
Sequence:CCGGCCTTGTGAAGAAGTATATGAACTCGAGTTCATATACTTCTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-1254s1c1
Sequence:CCGGCCTCGACACAATTACCACAAACTCGAGTTTGTGGTAATTGTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-990s1c1
Sequence:CCGGGTCCGCTTCTTCCTCACTTATCTCGAGATAAGTGAGGAAGAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-782s1c1
Sequence:CCGGGCATCCCTTCTTCTTTGCCTTCTCGAGAAGGCAAAGAAGAAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-1351s1c1
Sequence:CCGGCCGACATCATCCACTCACTAACTCGAGTTAGTGAGTGGATGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-317s1c1
Sequence:CCGGCCTTGTGAAGAAGTATATGAACTCGAGTTCATATACTTCTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013402
VALIDATED
FADS1 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1570s21c1
Sequence:CCGGCCGACATCATCCACTCACTAACTCGAGTTAGTGAGTGGATGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1001s21c1
Sequence:CCGGGCATCCCTTCTTCTTTGCCTTCTCGAGAAGGCAAAGAAGAAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1473s21c1
Sequence:CCGGCCTCGACACAATTACCACAAACTCGAGTTTGTGGTAATTGTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1209s21c1
Sequence:CCGGGTCCGCTTCTTCCTCACTTATCTCGAGATAAGTGAGGAAGAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-536s21c1
Sequence:CCGGCCTTGTGAAGAAGTATATGAACTCGAGTTCATATACTTCTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-1254s1c1
Sequence:CCGGCCTCGACACAATTACCACAAACTCGAGTTTGTGGTAATTGTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-990s1c1
Sequence:CCGGGTCCGCTTCTTCCTCACTTATCTCGAGATAAGTGAGGAAGAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-782s1c1
Sequence:CCGGGCATCCCTTCTTCTTTGCCTTCTCGAGAAGGCAAAGAAGAAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-1351s1c1
Sequence:CCGGCCGACATCATCCACTCACTAACTCGAGTTAGTGAGTGGATGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-317s1c1
Sequence:CCGGCCTTGTGAAGAAGTATATGAACTCGAGTTCATATACTTCTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013402
VALIDATED
FADS1 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1570s21c1
Sequence:CCGGCCGACATCATCCACTCACTAACTCGAGTTAGTGAGTGGATGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1001s21c1
Sequence:CCGGGCATCCCTTCTTCTTTGCCTTCTCGAGAAGGCAAAGAAGAAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1473s21c1
Sequence:CCGGCCTCGACACAATTACCACAAACTCGAGTTTGTGGTAATTGTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-1209s21c1
Sequence:CCGGGTCCGCTTCTTCCTCACTTATCTCGAGATAAGTGAGGAAGAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013402.4-536s21c1
Sequence:CCGGCCTTGTGAAGAAGTATATGAACTCGAGTTCATATACTTCTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-1254s1c1
Sequence:CCGGCCTCGACACAATTACCACAAACTCGAGTTTGTGGTAATTGTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-990s1c1
Sequence:CCGGGTCCGCTTCTTCCTCACTTATCTCGAGATAAGTGAGGAAGAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-782s1c1
Sequence:CCGGGCATCCCTTCTTCTTTGCCTTCTCGAGAAGGCAAAGAAGAAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-1351s1c1
Sequence:CCGGCCGACATCATCCACTCACTAACTCGAGTTAGTGAGTGGATGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_013402.3-317s1c1
Sequence:CCGGCCTTGTGAAGAAGTATATGAACTCGAGTTCATATACTTCTTCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks