EMAIL THIS PAGE TO A FRIEND

FADS2

fatty acid desaturase 2

48 Gene Product Result for
Synonyms: D6D DES6 FADSD6 LLCDL2 SLL0262 TU13
Gene ID:
Human(9415) Summary: The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
Mouse(56473) fatty acid desaturase 2
Rat(83512) fatty acid desaturase 2
Zebrafish(140615) fatty acid desaturase 2
chicken(423122) fatty acid desaturase 2
dog(483792) fatty acid desaturase 2
domestic cat(101085071) fatty acid desaturase 2
cow(521822) fatty acid desaturase 2
domestic guinea pig(100724176) fatty acid desaturase 2
naked mole-rat(101726663) fatty acid desaturase 2
Goat(100861212) fatty acid desaturase 2
sheep(101108615) fatty acid desaturase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004265 Rosetta Predictions human pricing
NM_031344 Rosetta Predictions rat pricing
NM_019699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029608 predicted 997
2 SASI_Hs01_00029610 predicted 509
3 SASI_Hs01_00029611 predicted 259
4 SASI_Hs01_00029612 predicted 933
5 SASI_Hs02_00337230 predicted 906
6 SASI_Hs01_00029613 predicted 1049
7 SASI_Hs01_00029614 predicted 854
8 SASI_Hs01_00029615 predicted 843
9 SASI_Hs01_00029616 predicted 787
10 SASI_Hs01_00029617 predicted 378
11 SASI_Hs01_00029609 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110512 predicted 1076
2 SASI_Rn01_00110513 predicted 914
3 SASI_Rn01_00110514 predicted 580
4 SASI_Rn01_00110515 predicted 739
5 SASI_Rn01_00110516 predicted 286
6 SASI_Rn01_00110517 predicted 716
7 SASI_Rn01_00110518 predicted 943
8 SASI_Rn01_00110519 predicted 713
9 SASI_Rn01_00110520 predicted 1336
10 SASI_Rn01_00110521 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037892 predicted 622
2 SASI_Mm01_00037893 predicted 200
3 SASI_Mm01_00037894 predicted 623
4 SASI_Mm01_00037895 predicted 854
5 SASI_Mm01_00037896 predicted 480
6 SASI_Mm01_00037897 predicted 677
7 SASI_Mm01_00037899 predicted 616
8 SASI_Mm01_00037900 predicted 899
9 SASI_Mm01_00037901 predicted 1017
10 SASI_Mm02_00324800 predicted 567
11 SASI_Mm01_00037898 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004265
VALIDATED
FADS2 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-1062s1c1
Sequence:CCGGCCGGTTCTTCATCACCTACATCTCGAGATGTAGGTGATGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-1326s1c1
Sequence:CCGGCCGGCACAACTTACACAAGATCTCGAGATCTTGTGTAAGTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-699s1c1
Sequence:CCGGCCACCTGTCTGTCTACAGAAACTCGAGTTTCTGTAGACAGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-923s1c1
Sequence:CCGGCCTACAATCACCAGCACGAATCTCGAGATTCGTGCTGGTGATTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-456s1c1
Sequence:CCGGCCACGGCAAGAACTCAAAGATCTCGAGATCTTTGAGTTCTTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-1326s21c1
Sequence:CCGGCCGGCACAACTTACACAAGATCTCGAGATCTTGTGTAAGTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-456s21c1
Sequence:CCGGCCACGGCAAGAACTCAAAGATCTCGAGATCTTTGAGTTCTTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-699s21c1
Sequence:CCGGCCACCTGTCTGTCTACAGAAACTCGAGTTTCTGTAGACAGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-1062s21c1
Sequence:CCGGCCGGTTCTTCATCACCTACATCTCGAGATGTAGGTGATGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-923s21c1
Sequence:CCGGCCTACAATCACCAGCACGAATCTCGAGATTCGTGCTGGTGATTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004265
VALIDATED
FADS2 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-1062s1c1
Sequence:CCGGCCGGTTCTTCATCACCTACATCTCGAGATGTAGGTGATGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-1326s1c1
Sequence:CCGGCCGGCACAACTTACACAAGATCTCGAGATCTTGTGTAAGTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-699s1c1
Sequence:CCGGCCACCTGTCTGTCTACAGAAACTCGAGTTTCTGTAGACAGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-923s1c1
Sequence:CCGGCCTACAATCACCAGCACGAATCTCGAGATTCGTGCTGGTGATTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-456s1c1
Sequence:CCGGCCACGGCAAGAACTCAAAGATCTCGAGATCTTTGAGTTCTTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-1326s21c1
Sequence:CCGGCCGGCACAACTTACACAAGATCTCGAGATCTTGTGTAAGTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-456s21c1
Sequence:CCGGCCACGGCAAGAACTCAAAGATCTCGAGATCTTTGAGTTCTTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-699s21c1
Sequence:CCGGCCACCTGTCTGTCTACAGAAACTCGAGTTTCTGTAGACAGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-1062s21c1
Sequence:CCGGCCGGTTCTTCATCACCTACATCTCGAGATGTAGGTGATGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-923s21c1
Sequence:CCGGCCTACAATCACCAGCACGAATCTCGAGATTCGTGCTGGTGATTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004265
VALIDATED
FADS2 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-1062s1c1
Sequence:CCGGCCGGTTCTTCATCACCTACATCTCGAGATGTAGGTGATGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-1326s1c1
Sequence:CCGGCCGGCACAACTTACACAAGATCTCGAGATCTTGTGTAAGTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-699s1c1
Sequence:CCGGCCACCTGTCTGTCTACAGAAACTCGAGTTTCTGTAGACAGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-923s1c1
Sequence:CCGGCCTACAATCACCAGCACGAATCTCGAGATTCGTGCTGGTGATTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004265.2-456s1c1
Sequence:CCGGCCACGGCAAGAACTCAAAGATCTCGAGATCTTTGAGTTCTTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-1326s21c1
Sequence:CCGGCCGGCACAACTTACACAAGATCTCGAGATCTTGTGTAAGTTGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-456s21c1
Sequence:CCGGCCACGGCAAGAACTCAAAGATCTCGAGATCTTTGAGTTCTTGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-699s21c1
Sequence:CCGGCCACCTGTCTGTCTACAGAAACTCGAGTTTCTGTAGACAGACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-1062s21c1
Sequence:CCGGCCGGTTCTTCATCACCTACATCTCGAGATGTAGGTGATGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004265.2-923s21c1
Sequence:CCGGCCTACAATCACCAGCACGAATCTCGAGATTCGTGCTGGTGATTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019699
VALIDATED
FADS2 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-624s1c1
Sequence:CCGGCACCTTTCTGTCTATAAGAAACTCGAGTTTCTTATAGACAGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-830s1c1
Sequence:CCGGGAAGCTGAAATACCTGCCCTACTCGAGTAGGGCAGGTATTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019699.1-487s1c1
Sequence:CCGGCCCACATCATCGTCATGGAAACTCGAGTTTCCATGACGATGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-986s1c1
Sequence:CCGGGCGTTTCTTCTACACCTACATCTCGAGATGTAGGTGTAGAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-487s21c1
Sequence:CCGGCCCACATCATCGTCATGGAAACTCGAGTTTCCATGACGATGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-986s21c1
Sequence:CCGGGCGTTTCTTCTACACCTACATCTCGAGATGTAGGTGTAGAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-624s21c1
Sequence:CCGGCACCTTTCTGTCTATAAGAAACTCGAGTTTCTTATAGACAGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-754s21c1
Sequence:CCGGTCCACAAGGACCCGGACATAACTCGAGTTATGTCCGGGTCCTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019699
VALIDATED
FADS2 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-624s1c1
Sequence:CCGGCACCTTTCTGTCTATAAGAAACTCGAGTTTCTTATAGACAGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-830s1c1
Sequence:CCGGGAAGCTGAAATACCTGCCCTACTCGAGTAGGGCAGGTATTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019699.1-487s1c1
Sequence:CCGGCCCACATCATCGTCATGGAAACTCGAGTTTCCATGACGATGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-986s1c1
Sequence:CCGGGCGTTTCTTCTACACCTACATCTCGAGATGTAGGTGTAGAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-487s21c1
Sequence:CCGGCCCACATCATCGTCATGGAAACTCGAGTTTCCATGACGATGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-986s21c1
Sequence:CCGGGCGTTTCTTCTACACCTACATCTCGAGATGTAGGTGTAGAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-624s21c1
Sequence:CCGGCACCTTTCTGTCTATAAGAAACTCGAGTTTCTTATAGACAGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-754s21c1
Sequence:CCGGTCCACAAGGACCCGGACATAACTCGAGTTATGTCCGGGTCCTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019699
VALIDATED
FADS2 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-624s1c1
Sequence:CCGGCACCTTTCTGTCTATAAGAAACTCGAGTTTCTTATAGACAGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-830s1c1
Sequence:CCGGGAAGCTGAAATACCTGCCCTACTCGAGTAGGGCAGGTATTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019699.1-487s1c1
Sequence:CCGGCCCACATCATCGTCATGGAAACTCGAGTTTCCATGACGATGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019699.1-986s1c1
Sequence:CCGGGCGTTTCTTCTACACCTACATCTCGAGATGTAGGTGTAGAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-487s21c1
Sequence:CCGGCCCACATCATCGTCATGGAAACTCGAGTTTCCATGACGATGATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-986s21c1
Sequence:CCGGGCGTTTCTTCTACACCTACATCTCGAGATGTAGGTGTAGAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-624s21c1
Sequence:CCGGCACCTTTCTGTCTATAAGAAACTCGAGTTTCTTATAGACAGAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019699.1-754s21c1
Sequence:CCGGTCCACAAGGACCCGGACATAACTCGAGTTATGTCCGGGTCCTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks