EMAIL THIS PAGE TO A FRIEND

FADS3

fatty acid desaturase 3

49 Gene Product Result for
Synonyms: CYB5RP LLCDL3
UniProtKB ID: Q9Y5Q0, O60426
Gene ID:
Human(3995) Summary: The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
Mouse(60527) fatty acid desaturase 3
Rat(286922) fatty acid desaturase 3
domestic cat(101084227) fatty acid desaturase 3
dog(476062) fatty acid desaturase 3
cow(515925) fatty acid desaturase 3
sheep(101110466) fatty acid desaturase 3
Domestic Rabbit(100352453) fatty acid desaturase 3
naked mole-rat(101725824) fatty acid desaturase 3
domestic guinea pig(100723901) fatty acid desaturase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073571 MISSION® esiRNA esiRNA targeting mouse Fads3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021727 Rosetta Predictions human pricing
NM_173137 Rosetta Predictions rat pricing
NM_021890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216803 predicted 1153
2 SASI_Hs01_00216804 predicted 907
3 SASI_Hs01_00216805 predicted 1052
4 SASI_Hs01_00216806 predicted 982
5 SASI_Hs01_00216807 predicted 1391
6 SASI_Hs01_00216808 predicted 1035
7 SASI_Hs01_00216809 predicted 364
8 SASI_Hs01_00216811 predicted 886
9 SASI_Hs01_00216812 predicted 1004
10 SASI_Hs02_00355044 predicted 1437
11 SASI_Hs01_00216810 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043665 predicted 202
2 SASI_Rn02_00269313 predicted 460
3 SASI_Rn02_00269314 predicted 1195
4 SASI_Rn01_00043666 predicted 1092
5 SASI_Rn01_00043667 predicted 861
6 SASI_Rn01_00043669 predicted 653
7 SASI_Rn01_00043670 predicted 829
8 SASI_Rn01_00043671 predicted 1095
9 SASI_Rn01_00043672 predicted 916
10 SASI_Rn01_00043673 predicted 857
11 SASI_Rn01_00043664 predicted 926
12 SASI_Rn01_00043668 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164411 predicted 1094
2 SASI_Mm01_00164412 predicted 574
3 SASI_Mm01_00164413 predicted 1048
4 SASI_Mm01_00164414 predicted 568
5 SASI_Mm01_00164416 predicted 635
6 SASI_Mm01_00164417 predicted 930
7 SASI_Mm01_00164418 predicted 1462
8 SASI_Mm01_00164419 predicted 959
9 SASI_Mm01_00164420 predicted 630
10 SASI_Mm02_00326456 predicted 1498
11 SASI_Mm01_00164415 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021727
FADS3 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021727.3-1472s21c1
Sequence:CCGGACGCCTACCTCCATCAGTGAACTCGAGTTCACTGATGGAGGTAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021727.3-1023s21c1
Sequence:CCGGGTGCATGCAGTGGGCGGATTTCTCGAGAAATCCGCCCACTGCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-1443s1c1
Sequence:CCGGCCTGAAGAAGTCTGGTGACATCTCGAGATGTCACCAGACTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-903s1c1
Sequence:CCGGTGGCAAGAAGAAACGCAGATACTCGAGTATCTGCGTTTCTTCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-1068s1c1
Sequence:CCGGCCGCTTCTTCTTATCCTACCTCTCGAGAGGTAGGATAAGAAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-380s1c1
Sequence:CCGGCCTTCCATCAAGATCTCAATTCTCGAGAATTGAGATCTTGATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-517s1c1
Sequence:CCGGGCCGAGGACATGAAGCTGTTTCTCGAGAAACAGCTTCATGTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021727
FADS3 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021727.3-1472s21c1
Sequence:CCGGACGCCTACCTCCATCAGTGAACTCGAGTTCACTGATGGAGGTAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021727.3-1023s21c1
Sequence:CCGGGTGCATGCAGTGGGCGGATTTCTCGAGAAATCCGCCCACTGCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-1443s1c1
Sequence:CCGGCCTGAAGAAGTCTGGTGACATCTCGAGATGTCACCAGACTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-903s1c1
Sequence:CCGGTGGCAAGAAGAAACGCAGATACTCGAGTATCTGCGTTTCTTCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-1068s1c1
Sequence:CCGGCCGCTTCTTCTTATCCTACCTCTCGAGAGGTAGGATAAGAAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-380s1c1
Sequence:CCGGCCTTCCATCAAGATCTCAATTCTCGAGAATTGAGATCTTGATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-517s1c1
Sequence:CCGGGCCGAGGACATGAAGCTGTTTCTCGAGAAACAGCTTCATGTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021727
FADS3 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021727.3-1472s21c1
Sequence:CCGGACGCCTACCTCCATCAGTGAACTCGAGTTCACTGATGGAGGTAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021727.3-1023s21c1
Sequence:CCGGGTGCATGCAGTGGGCGGATTTCTCGAGAAATCCGCCCACTGCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-1443s1c1
Sequence:CCGGCCTGAAGAAGTCTGGTGACATCTCGAGATGTCACCAGACTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-903s1c1
Sequence:CCGGTGGCAAGAAGAAACGCAGATACTCGAGTATCTGCGTTTCTTCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-1068s1c1
Sequence:CCGGCCGCTTCTTCTTATCCTACCTCTCGAGAGGTAGGATAAGAAGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-380s1c1
Sequence:CCGGCCTTCCATCAAGATCTCAATTCTCGAGAATTGAGATCTTGATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021727.3-517s1c1
Sequence:CCGGGCCGAGGACATGAAGCTGTTTCTCGAGAAACAGCTTCATGTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021890
VALIDATED
FADS3 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-947s21c1
Sequence:CCGGGGCAAGAAGAAACGCAGATACCTCGAGGTATCTGCGTTTCTTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-286s21c1
Sequence:CCGGGCATGACCTACCAGGCGACAACTCGAGTTGTCGCCTGGTAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-752s21c1
Sequence:CCGGCATGCTTCCATCTTCACTAAGCTCGAGCTTAGTGAAGATGGAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021890.3-1891s21c1
Sequence:CCGGTTGGTGGAAGGGCCATCATTGCTCGAGCAATGATGGCCCTTCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-1296s21c1
Sequence:CCGGTGGAACCTTCGCTCTTCATTGCTCGAGCAATGAAGAGCGAAGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021890.3-2258s1c1
Sequence:CCGGGCAGGAACTAACCTCTCACTTCTCGAGAAGTGAGAGGTTAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021890.3-763s1c1
Sequence:CCGGCTTCACTAAGTCCAGGTGGAACTCGAGTTCCACCTGGACTTAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021890.3-286s1c1
Sequence:CCGGGCATGACCTACCAGGCGACAACTCGAGTTGTCGCCTGGTAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021890.3-1305s1c1
Sequence:CCGGCGCTCTTCATTGACTGGTTCACTCGAGTGAACCAGTCAATGAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021890.3-1097s1c1
Sequence:CCGGGCCAGTTTCTACTCCCGCTTTCTCGAGAAAGCGGGAGTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021890
VALIDATED
FADS3 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-947s21c1
Sequence:CCGGGGCAAGAAGAAACGCAGATACCTCGAGGTATCTGCGTTTCTTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-286s21c1
Sequence:CCGGGCATGACCTACCAGGCGACAACTCGAGTTGTCGCCTGGTAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-752s21c1
Sequence:CCGGCATGCTTCCATCTTCACTAAGCTCGAGCTTAGTGAAGATGGAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021890.3-1891s21c1
Sequence:CCGGTTGGTGGAAGGGCCATCATTGCTCGAGCAATGATGGCCCTTCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-1296s21c1
Sequence:CCGGTGGAACCTTCGCTCTTCATTGCTCGAGCAATGAAGAGCGAAGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021890.3-2258s1c1
Sequence:CCGGGCAGGAACTAACCTCTCACTTCTCGAGAAGTGAGAGGTTAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021890.3-763s1c1
Sequence:CCGGCTTCACTAAGTCCAGGTGGAACTCGAGTTCCACCTGGACTTAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021890.3-286s1c1
Sequence:CCGGGCATGACCTACCAGGCGACAACTCGAGTTGTCGCCTGGTAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021890.3-1305s1c1
Sequence:CCGGCGCTCTTCATTGACTGGTTCACTCGAGTGAACCAGTCAATGAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021890.3-1097s1c1
Sequence:CCGGGCCAGTTTCTACTCCCGCTTTCTCGAGAAAGCGGGAGTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021890
VALIDATED
FADS3 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-947s21c1
Sequence:CCGGGGCAAGAAGAAACGCAGATACCTCGAGGTATCTGCGTTTCTTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-286s21c1
Sequence:CCGGGCATGACCTACCAGGCGACAACTCGAGTTGTCGCCTGGTAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-752s21c1
Sequence:CCGGCATGCTTCCATCTTCACTAAGCTCGAGCTTAGTGAAGATGGAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021890.3-1891s21c1
Sequence:CCGGTTGGTGGAAGGGCCATCATTGCTCGAGCAATGATGGCCCTTCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021890.3-1296s21c1
Sequence:CCGGTGGAACCTTCGCTCTTCATTGCTCGAGCAATGAAGAGCGAAGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021890.3-2258s1c1
Sequence:CCGGGCAGGAACTAACCTCTCACTTCTCGAGAAGTGAGAGGTTAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021890.3-763s1c1
Sequence:CCGGCTTCACTAAGTCCAGGTGGAACTCGAGTTCCACCTGGACTTAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021890.3-286s1c1
Sequence:CCGGGCATGACCTACCAGGCGACAACTCGAGTTGTCGCCTGGTAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021890.3-1305s1c1
Sequence:CCGGCGCTCTTCATTGACTGGTTCACTCGAGTGAACCAGTCAATGAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021890.3-1097s1c1
Sequence:CCGGGCCAGTTTCTACTCCCGCTTTCTCGAGAAAGCGGGAGTAGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks