EMAIL THIS PAGE TO A FRIEND

FADS6

fatty acid desaturase 6

UniProtKB ID: Q8N9I5, Q17RQ7, Q6XYE1
Gene ID:
Mouse(328035) fatty acid desaturase domain family, member 6
Rat(303671) fatty acid desaturase 6
domestic guinea pig(100715860) fatty acid desaturase 6
naked mole-rat(101716330) fatty acid desaturase 6
sheep(101102657) fatty acid desaturase domain family, member 6
chicken(428683) fatty acid desaturase domain family, member 6
dog(609709) fatty acid desaturase domain family, member 6
cow(523867) fatty acid desaturase domain family, member 6
domestic cat(101091980) fatty acid desaturase domain family, member 6
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178128 Rosetta Predictions human pricing
NM_001107064 Rosetta Predictions rat pricing
NM_178035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125924 predicted 219
2 SASI_Hs01_00125925 predicted 723
3 SASI_Hs01_00125926 predicted 1296
4 SASI_Hs01_00125928 predicted 1276
5 SASI_Hs01_00125929 predicted 1309
6 SASI_Hs01_00125930 predicted 955
7 SASI_Hs01_00125931 predicted 750
8 SASI_Hs01_00125932 predicted 898
9 SASI_Hs01_00125933 predicted 245
10 SASI_Hs02_00369538 predicted 1370
11 SASI_Hs01_00125927 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225136 predicted 732
2 SASI_Rn02_00225137 predicted 896
3 SASI_Rn02_00225138 predicted 609
4 SASI_Rn02_00225139 predicted 942
5 SASI_Rn02_00225140 predicted 956
6 SASI_Rn02_00225141 predicted 1227
7 SASI_Rn02_00225142 predicted 393
8 SASI_Rn02_00225143 predicted 243
9 SASI_Rn02_00225144 predicted 1223
10 SASI_Rn02_00225145 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168251 predicted 224
2 SASI_Mm01_00168252 predicted 895
3 SASI_Mm01_00168253 predicted 401
4 SASI_Mm01_00168254 predicted 878
5 SASI_Mm02_00348489 predicted 941
6 SASI_Mm01_00168255 predicted 708
7 SASI_Mm01_00168256 predicted 329
8 SASI_Mm01_00168257 predicted 616
9 SASI_Mm01_00168258 predicted 239
10 SASI_Mm01_00168259 predicted 259
11 SASI_Mm01_00168260 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178128
FADS6 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-972s1c1
Sequence:CCGGGCCATGTGGAACACCATCTATCTCGAGATAGATGGTGTTCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-1111s1c1
Sequence:CCGGCCGTCGCTATGAGGAATTCATCTCGAGATGAATTCCTCATAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-376s1c1
Sequence:CCGGCCACTACACACTCACTGTCAACTCGAGTTGACAGTGAGTGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-783s1c1
Sequence:CCGGGCTGCATGTTCCTCACCAGATCTCGAGATCTGGTGAGGAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-337s1c1
Sequence:CCGGCCTGGTCTTTGCATCCGGCATCTCGAGATGCCGGATGCAAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178128.3-598s21c1
Sequence:CCGGCTGATTTCTCTGGGCCTTTATCTCGAGATAAAGGCCCAGAGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178128.3-1319s21c1
Sequence:CCGGCAACTTCATCTCAGGACTAAACTCGAGTTTAGTCCTGAGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178128
FADS6 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-972s1c1
Sequence:CCGGGCCATGTGGAACACCATCTATCTCGAGATAGATGGTGTTCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-1111s1c1
Sequence:CCGGCCGTCGCTATGAGGAATTCATCTCGAGATGAATTCCTCATAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-376s1c1
Sequence:CCGGCCACTACACACTCACTGTCAACTCGAGTTGACAGTGAGTGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-783s1c1
Sequence:CCGGGCTGCATGTTCCTCACCAGATCTCGAGATCTGGTGAGGAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-337s1c1
Sequence:CCGGCCTGGTCTTTGCATCCGGCATCTCGAGATGCCGGATGCAAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178128.3-598s21c1
Sequence:CCGGCTGATTTCTCTGGGCCTTTATCTCGAGATAAAGGCCCAGAGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178128.3-1319s21c1
Sequence:CCGGCAACTTCATCTCAGGACTAAACTCGAGTTTAGTCCTGAGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178128
FADS6 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-972s1c1
Sequence:CCGGGCCATGTGGAACACCATCTATCTCGAGATAGATGGTGTTCCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-1111s1c1
Sequence:CCGGCCGTCGCTATGAGGAATTCATCTCGAGATGAATTCCTCATAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-376s1c1
Sequence:CCGGCCACTACACACTCACTGTCAACTCGAGTTGACAGTGAGTGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-783s1c1
Sequence:CCGGGCTGCATGTTCCTCACCAGATCTCGAGATCTGGTGAGGAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178128.2-337s1c1
Sequence:CCGGCCTGGTCTTTGCATCCGGCATCTCGAGATGCCGGATGCAAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178128.3-598s21c1
Sequence:CCGGCTGATTTCTCTGGGCCTTTATCTCGAGATAAAGGCCCAGAGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178128.3-1319s21c1
Sequence:CCGGCAACTTCATCTCAGGACTAAACTCGAGTTTAGTCCTGAGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178035
VALIDATED
FADS6 MISSION shRNA Bacterial Glycerol Stock
fatty acid desaturase 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-932s1c1
Sequence:CCGGGTCGAAGTTTCTCCACGAGAACTCGAGTTCTCGTGGAGAAACTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-959s1c1
Sequence:CCGGGCCTTACAATGAAGACTCATACTCGAGTATGAGTCTTCATTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-486s1c1
Sequence:CCGGCGCTACGTTTACATGTTCCTTCTCGAGAAGGAACATGTAAACGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-396s1c1
Sequence:CCGGGCCAAATTCAACCACGTGAATCTCGAGATTCACGTGGTTGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178035.3-269s1c1
Sequence:CCGGCCATTATACACTCACCGTCAACTCGAGTTGACGGTGAGTGTATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178035.3-635s1c1
Sequence:CCGGCATGAATGTGTCAGGCTTCAACTCGAGTTGAAGCCTGACACATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-568s21c1
Sequence:CCGGGCTGGTAGCTCTTGAGCATTTCTCGAGAAATGCTCAAGAGCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-496s21c1
Sequence:CCGGGTGGAAGGTGCCTCTCCTCAACTCGAGTTGAGGAGAGGCACCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-743s21c1
Sequence:CCGGCCTTATCTCCATGTCAATATCCTCGAGGATATTGACATGGAGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-615s21c1
Sequence:CCGGTGCGGACTTTGGGCTTCATCTCTCGAGAGATGAAGCCCAAAGTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-695s21c1
Sequence:CCGGAGTTCAGCACTGGCCTGCATGCTCGAGCATGCAGGCCAGTGCTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-271s21c1
Sequence:CCGGTGCCACGGGCATCACAATCTTCTCGAGAAGATTGTGATGCCCGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178035
VALIDATED
FADS6 MISSION shRNA shRNA Plasmid DNA
fatty acid desaturase 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-932s1c1
Sequence:CCGGGTCGAAGTTTCTCCACGAGAACTCGAGTTCTCGTGGAGAAACTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-959s1c1
Sequence:CCGGGCCTTACAATGAAGACTCATACTCGAGTATGAGTCTTCATTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-486s1c1
Sequence:CCGGCGCTACGTTTACATGTTCCTTCTCGAGAAGGAACATGTAAACGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-396s1c1
Sequence:CCGGGCCAAATTCAACCACGTGAATCTCGAGATTCACGTGGTTGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178035.3-269s1c1
Sequence:CCGGCCATTATACACTCACCGTCAACTCGAGTTGACGGTGAGTGTATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178035.3-635s1c1
Sequence:CCGGCATGAATGTGTCAGGCTTCAACTCGAGTTGAAGCCTGACACATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-568s21c1
Sequence:CCGGGCTGGTAGCTCTTGAGCATTTCTCGAGAAATGCTCAAGAGCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-496s21c1
Sequence:CCGGGTGGAAGGTGCCTCTCCTCAACTCGAGTTGAGGAGAGGCACCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-743s21c1
Sequence:CCGGCCTTATCTCCATGTCAATATCCTCGAGGATATTGACATGGAGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-615s21c1
Sequence:CCGGTGCGGACTTTGGGCTTCATCTCTCGAGAGATGAAGCCCAAAGTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-695s21c1
Sequence:CCGGAGTTCAGCACTGGCCTGCATGCTCGAGCATGCAGGCCAGTGCTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-271s21c1
Sequence:CCGGTGCCACGGGCATCACAATCTTCTCGAGAAGATTGTGATGCCCGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178035
VALIDATED
FADS6 MISSION shRNA Lentiviral Transduction Particles
fatty acid desaturase 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-932s1c1
Sequence:CCGGGTCGAAGTTTCTCCACGAGAACTCGAGTTCTCGTGGAGAAACTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-959s1c1
Sequence:CCGGGCCTTACAATGAAGACTCATACTCGAGTATGAGTCTTCATTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-486s1c1
Sequence:CCGGCGCTACGTTTACATGTTCCTTCTCGAGAAGGAACATGTAAACGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178035.3-396s1c1
Sequence:CCGGGCCAAATTCAACCACGTGAATCTCGAGATTCACGTGGTTGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178035.3-269s1c1
Sequence:CCGGCCATTATACACTCACCGTCAACTCGAGTTGACGGTGAGTGTATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178035.3-635s1c1
Sequence:CCGGCATGAATGTGTCAGGCTTCAACTCGAGTTGAAGCCTGACACATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-568s21c1
Sequence:CCGGGCTGGTAGCTCTTGAGCATTTCTCGAGAAATGCTCAAGAGCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-496s21c1
Sequence:CCGGGTGGAAGGTGCCTCTCCTCAACTCGAGTTGAGGAGAGGCACCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-743s21c1
Sequence:CCGGCCTTATCTCCATGTCAATATCCTCGAGGATATTGACATGGAGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-615s21c1
Sequence:CCGGTGCGGACTTTGGGCTTCATCTCTCGAGAGATGAAGCCCAAAGTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-695s21c1
Sequence:CCGGAGTTCAGCACTGGCCTGCATGCTCGAGCATGCAGGCCAGTGCTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178035.4-271s21c1
Sequence:CCGGTGCCACGGGCATCACAATCTTCTCGAGAAGATTGTGATGCCCGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks