EMAIL THIS PAGE TO A FRIEND

FAF1

Fas (TNFRSF6) associated factor 1

90 Gene Product Result for
Synonyms: HFAF1s UBXD12 UBXN3A hFAF1
UniProtKB ID: Q9UNN5, Q549F0, Q9UF34, Q9UNT3, Q9Y2Z3
Gene ID:
Human(11124) Summary: Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
Mouse(14084) Fas-associated factor 1
Rat(140657) Fas (TNFRSF6) associated factor 1
Zebrafish(406243) Fas associated factor 1
domestic cat(101091034) Fas (TNFRSF6) associated factor 1
cow(531770) Fas (TNFRSF6) associated factor 1
Horse(100062977) Fas (TNFRSF6) associated factor 1
dog(608231) Fas (TNFRSF6) associated factor 1
chicken(424629) Fas (TNFRSF6) associated factor 1
sheep(101108967) Fas (TNFRSF6) associated factor 1
Domestic Rabbit(100351925) Fas (TNFRSF6) associated factor 1
naked mole-rat(101722424) Fas (TNFRSF6) associated factor 1
domestic guinea pig(100727357) Fas (TNFRSF6) associated factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060921 MISSION® esiRNA esiRNA human FAF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007051 Rosetta Predictions human pricing
NM_131917 Rosetta Predictions human pricing
NM_130406 Rosetta Predictions rat pricing
NM_007983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229540 predicted 2317
2 SASI_Hs02_00342839 predicted 1102
3 SASI_Hs01_00229542 predicted 2064
4 SASI_Hs02_00342840 predicted 1113
5 SASI_Hs02_00342841 predicted 1170
6 SASI_Hs02_00342842 predicted 1369
7 SASI_Hs02_00342843 predicted 1626
8 SASI_Hs02_00342844 predicted 1556
9 SASI_Hs01_00229543 predicted 1888
10 SASI_Hs01_00229544 predicted 626
11 SASI_Hs01_00229539 predicted 2232
12 SASI_Hs01_00229541 predicted 1858
13 SASI_Hs01_00229545 predicted 1847
14 SASI_Hs01_00229546 predicted 1831
15 SASI_Hs01_00229547 predicted 715
16 SASI_Hs01_00229548 predicted 2345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204658 predicted 1771
2 SASI_Hs01_00204659 predicted 1870
3 SASI_Hs01_00204660 predicted 1409
4 SASI_Hs01_00204661 predicted 1607
5 SASI_Hs01_00204662 predicted 1430
6 SASI_Hs01_00204663 predicted 634
7 SASI_Hs01_00204664 predicted 1389
8 SASI_Hs01_00204665 predicted 1377
9 SASI_Hs01_00204666 predicted 715
10 SASI_Hs01_00204667 predicted 1889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045549 predicted 897
2 SASI_Rn01_00045550 predicted 1778
3 SASI_Rn01_00045551 predicted 1356
4 SASI_Rn01_00045552 predicted 1857
5 SASI_Rn01_00045553 predicted 1612
6 SASI_Rn02_00267392 predicted 1158
7 SASI_Rn01_00045555 predicted 759
8 SASI_Rn01_00045556 predicted 1576
9 SASI_Rn01_00045558 predicted 1528
10 SASI_Rn02_00267393 predicted 997
11 SASI_Rn01_00045554 predicted 2014
12 SASI_Rn01_00045557 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028312 predicted 1794
2 SASI_Mm01_00028314 predicted 2002
3 SASI_Mm01_00028315 predicted 1159
4 SASI_Mm01_00028317 predicted 1773
5 SASI_Mm02_00312890 predicted 1206
6 SASI_Mm01_00028318 predicted 1686
7 SASI_Mm01_00028319 predicted 1060
8 SASI_Mm01_00028320 predicted 1144
9 SASI_Mm02_00312891 predicted 1547
10 SASI_Mm02_00312892 predicted 882
11 SASI_Mm01_00028313 predicted 1054
12 SASI_Mm01_00028316 predicted 1594
13 SASI_Mm01_00028321 predicted 1826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007051
VALIDATED
FAF1 MISSION shRNA Bacterial Glycerol Stock
Fas (TNFRSF6) associated factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007051.2-1918s21c1
Sequence:CCGGGCCCAACAACAGGAAGATATACTCGAGTATATCTTCCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-2491s21c1
Sequence:CCGGCGCTCGTCTCACTCAATTCAACTCGAGTTGAATTGAGTGAGACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-1762s21c1
Sequence:CCGGGCACAAACCATTCGGACTCAACTCGAGTTGAGTCCGAATGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-809s21c1
Sequence:CCGGCCTGTACTGTTGGAGAGATTACTCGAGTAATCTCTCCAACAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-1762s1c1
Sequence:CCGGGCACAAACCATTCGGACTCAACTCGAGTTGAGTCCGAATGGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-809s1c1
Sequence:CCGGCCTGTACTGTTGGAGAGATTACTCGAGTAATCTCTCCAACAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007051.x-2322s1c1
Sequence:CCGGCGTAACTCAACTGGACCCAAACTCGAGTTTGGGTCCAGTTGAGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-2491s1c1
Sequence:CCGGCGCTCGTCTCACTCAATTCAACTCGAGTTGAATTGAGTGAGACGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007051
VALIDATED
FAF1 MISSION shRNA shRNA Plasmid DNA
Fas (TNFRSF6) associated factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007051.2-1918s21c1
Sequence:CCGGGCCCAACAACAGGAAGATATACTCGAGTATATCTTCCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-2491s21c1
Sequence:CCGGCGCTCGTCTCACTCAATTCAACTCGAGTTGAATTGAGTGAGACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-1762s21c1
Sequence:CCGGGCACAAACCATTCGGACTCAACTCGAGTTGAGTCCGAATGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-809s21c1
Sequence:CCGGCCTGTACTGTTGGAGAGATTACTCGAGTAATCTCTCCAACAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-1762s1c1
Sequence:CCGGGCACAAACCATTCGGACTCAACTCGAGTTGAGTCCGAATGGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-809s1c1
Sequence:CCGGCCTGTACTGTTGGAGAGATTACTCGAGTAATCTCTCCAACAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007051.x-2322s1c1
Sequence:CCGGCGTAACTCAACTGGACCCAAACTCGAGTTTGGGTCCAGTTGAGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-2491s1c1
Sequence:CCGGCGCTCGTCTCACTCAATTCAACTCGAGTTGAATTGAGTGAGACGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007051
VALIDATED
FAF1 MISSION shRNA Lentiviral Transduction Particles
Fas (TNFRSF6) associated factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007051.2-1918s21c1
Sequence:CCGGGCCCAACAACAGGAAGATATACTCGAGTATATCTTCCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-2491s21c1
Sequence:CCGGCGCTCGTCTCACTCAATTCAACTCGAGTTGAATTGAGTGAGACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-1762s21c1
Sequence:CCGGGCACAAACCATTCGGACTCAACTCGAGTTGAGTCCGAATGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007051.2-809s21c1
Sequence:CCGGCCTGTACTGTTGGAGAGATTACTCGAGTAATCTCTCCAACAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-1762s1c1
Sequence:CCGGGCACAAACCATTCGGACTCAACTCGAGTTGAGTCCGAATGGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-809s1c1
Sequence:CCGGCCTGTACTGTTGGAGAGATTACTCGAGTAATCTCTCCAACAGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007051.x-2322s1c1
Sequence:CCGGCGTAACTCAACTGGACCCAAACTCGAGTTTGGGTCCAGTTGAGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007051.x-2491s1c1
Sequence:CCGGCGCTCGTCTCACTCAATTCAACTCGAGTTGAATTGAGTGAGACGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007983
VALIDATED
FAF1 MISSION shRNA Bacterial Glycerol Stock
Fas (TNFRSF6) associated factor 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007983.2-2516s21c1
Sequence:CCGGATTTCCCATCCATGAGTATATCTCGAGATATACTCATGGATGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-848s1c1
Sequence:CCGGGGAAGACAGTACGGTCTTAAACTCGAGTTTAAGACCGTACTGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-1168s1c1
Sequence:CCGGCTTATCCCTGCCATCGATTAACTCGAGTTAATCGATGGCAGGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1039s21c1
Sequence:CCGGGCAGTACCGTTCAAGAGGTAACTCGAGTTACCTCTTGAACGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1063s21c1
Sequence:CCGGGAAATGTGTATGACCTTACAACTCGAGTTGTAAGGTCATACACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1169s21c1
Sequence:CCGGTTATCCCTGCCATCGATTAACCTCGAGGTTAATCGATGGCAGGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007983.2-1708s21c1
Sequence:CCGGCACAAACTATTCGGACTCAAACTCGAGTTTGAGTCCGAATAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007983.2-2739s1c1
Sequence:CCGGCCTCTGCCTTTACCTTTCTATCTCGAGATAGAAAGGTAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-1770s1c1
Sequence:CCGGCGATCATCTAATGAAGTGTTACTCGAGTAACACTTCATTAGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007983.2-1039s1c1
Sequence:CCGGGCAGTACCGTTCAAGAGGTAACTCGAGTTACCTCTTGAACGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007983.2-1708s1c1
Sequence:CCGGCACAAACTATTCGGACTCAAACTCGAGTTTGAGTCCGAATAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007983.2-1063s1c1
Sequence:CCGGGAAATGTGTATGACCTTACAACTCGAGTTGTAAGGTCATACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007983.2-3933s1c1
Sequence:CCGGCCCAAGAAAGTTCACCTGTTTCTCGAGAAACAGGTGAACTTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007983
VALIDATED
FAF1 MISSION shRNA shRNA Plasmid DNA
Fas (TNFRSF6) associated factor 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007983.2-2516s21c1
Sequence:CCGGATTTCCCATCCATGAGTATATCTCGAGATATACTCATGGATGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-848s1c1
Sequence:CCGGGGAAGACAGTACGGTCTTAAACTCGAGTTTAAGACCGTACTGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-1168s1c1
Sequence:CCGGCTTATCCCTGCCATCGATTAACTCGAGTTAATCGATGGCAGGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1039s21c1
Sequence:CCGGGCAGTACCGTTCAAGAGGTAACTCGAGTTACCTCTTGAACGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1063s21c1
Sequence:CCGGGAAATGTGTATGACCTTACAACTCGAGTTGTAAGGTCATACACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1169s21c1
Sequence:CCGGTTATCCCTGCCATCGATTAACCTCGAGGTTAATCGATGGCAGGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007983.2-1708s21c1
Sequence:CCGGCACAAACTATTCGGACTCAAACTCGAGTTTGAGTCCGAATAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007983.2-2739s1c1
Sequence:CCGGCCTCTGCCTTTACCTTTCTATCTCGAGATAGAAAGGTAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-1770s1c1
Sequence:CCGGCGATCATCTAATGAAGTGTTACTCGAGTAACACTTCATTAGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007983.2-1039s1c1
Sequence:CCGGGCAGTACCGTTCAAGAGGTAACTCGAGTTACCTCTTGAACGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007983.2-1708s1c1
Sequence:CCGGCACAAACTATTCGGACTCAAACTCGAGTTTGAGTCCGAATAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007983.2-1063s1c1
Sequence:CCGGGAAATGTGTATGACCTTACAACTCGAGTTGTAAGGTCATACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007983.2-3933s1c1
Sequence:CCGGCCCAAGAAAGTTCACCTGTTTCTCGAGAAACAGGTGAACTTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007983
VALIDATED
FAF1 MISSION shRNA Lentiviral Transduction Particles
Fas (TNFRSF6) associated factor 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007983.2-2516s21c1
Sequence:CCGGATTTCCCATCCATGAGTATATCTCGAGATATACTCATGGATGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-848s1c1
Sequence:CCGGGGAAGACAGTACGGTCTTAAACTCGAGTTTAAGACCGTACTGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-1168s1c1
Sequence:CCGGCTTATCCCTGCCATCGATTAACTCGAGTTAATCGATGGCAGGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1039s21c1
Sequence:CCGGGCAGTACCGTTCAAGAGGTAACTCGAGTTACCTCTTGAACGGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1063s21c1
Sequence:CCGGGAAATGTGTATGACCTTACAACTCGAGTTGTAAGGTCATACACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007983.2-1169s21c1
Sequence:CCGGTTATCCCTGCCATCGATTAACCTCGAGGTTAATCGATGGCAGGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007983.2-1708s21c1
Sequence:CCGGCACAAACTATTCGGACTCAAACTCGAGTTTGAGTCCGAATAGTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007983.2-2739s1c1
Sequence:CCGGCCTCTGCCTTTACCTTTCTATCTCGAGATAGAAAGGTAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007983.2-1770s1c1
Sequence:CCGGCGATCATCTAATGAAGTGTTACTCGAGTAACACTTCATTAGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007983.2-1039s1c1
Sequence:CCGGGCAGTACCGTTCAAGAGGTAACTCGAGTTACCTCTTGAACGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007983.2-1708s1c1
Sequence:CCGGCACAAACTATTCGGACTCAAACTCGAGTTTGAGTCCGAATAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007983.2-1063s1c1
Sequence:CCGGGAAATGTGTATGACCTTACAACTCGAGTTGTAAGGTCATACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007983.2-3933s1c1
Sequence:CCGGCCCAAGAAAGTTCACCTGTTTCTCGAGAAACAGGTGAACTTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks