EMAIL THIS PAGE TO A FRIEND

FAF2

Fas associated factor family member 2

119 Gene Product Result for
Synonyms: ETEA UBXD8 UBXN3B
UniProtKB ID: Q96CS3, O94963, Q8IUF2, Q9BRP2, Q9BVM7
Gene ID:
Human(23197) Summary: The protein encoded by this gene is highly expressed in peripheral blood of patients with atopic dermatitis (AD), compared to normal individuals. It may play a role in regulating the resistance to apoptosis that is observed in T cells and eosinophils of AD patients. [provided by RefSeq, Jul 2008]
Mouse(76577) Fas associated factor family member 2
Rat(291000) Fas associated factor family member 2
domestic guinea pig(100723749) Fas associated factor family member 2
naked mole-rat(101712781) Fas associated factor family member 2
sheep(101117757) Fas associated factor family member 2
Domestic Rabbit(100352486) Fas associated factor family member 2
Zebrafish(497596) Fas associated factor family member 2
dog(489102) Fas associated factor family member 2
cow(767948) Fas associated factor family member 2
Horse(100068860) Fas associated factor family member 2
domestic cat(101081952) Fas associated factor family member 2
chicken(416225) Fas associated factor family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014613 Rosetta Predictions human pricing
NM_001017445 Rosetta Predictions rat pricing
NM_178397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205252 predicted 357
2 SASI_Hs01_00205253 predicted 787
3 SASI_Hs01_00205254 predicted 273
4 SASI_Hs01_00205256 predicted 747
5 SASI_Hs01_00205257 predicted 820
6 SASI_Hs01_00205258 predicted 840
7 SASI_Hs01_00205259 predicted 721
8 SASI_Hs02_00345901 predicted 346
9 SASI_Hs02_00345902 predicted 1157
10 SASI_Hs02_00345903 predicted 515
11 SASI_Hs01_00205251 predicted 1110
12 SASI_Hs01_00205255 predicted 1192
13 SASI_Hs01_00205260 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064139 predicted 612
2 SASI_Rn01_00064140 predicted 333
3 SASI_Rn01_00064141 predicted 1148
4 SASI_Rn01_00064142 predicted 1194
5 SASI_Rn01_00064143 predicted 747
6 SASI_Rn01_00064144 predicted 328
7 SASI_Rn01_00064145 predicted 1170
8 SASI_Rn02_00202233 predicted 727
9 SASI_Rn01_00064146 predicted 1087
10 SASI_Rn02_00202234 predicted 713
11 SASI_Rn01_00064147 predicted 712
12 SASI_Rn01_00064148 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348808 predicted 358
2 SASI_Mm02_00348809 predicted 361
3 SASI_Mm02_00348810 predicted 725
4 SASI_Mm02_00348811 predicted 358
5 SASI_Mm02_00348812 predicted 744
6 SASI_Mm02_00348813 predicted 723
7 SASI_Mm02_00348814 predicted 1840
8 SASI_Mm02_00348815 predicted 526
9 SASI_Mm02_00348816 predicted 294
10 SASI_Mm02_00348817 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014613
VALIDATED
FAF2 MISSION shRNA Bacterial Glycerol Stock
Fas associated factor family member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-1192s1c1
Sequence:CCGGCCACGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014613.x-1037s1c1
Sequence:CCGGCGGCAGAATTTACAGGAGGAACTCGAGTTCCTCCTGTAAATTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-331s1c1
Sequence:CCGGGCTTCCATTCCGGTTTACCTACTCGAGTAGGTAAACCGGAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-701s1c1
Sequence:CCGGGCTTTACGAGAGAACACCTATCTCGAGATAGGTGTTCTCTCGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-1597s21c1
Sequence:CCGGCGCGCAAGGTTAGCAACAAACCTCGAGGTTTGTTGCTAACCTTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-353s21c1
Sequence:CCGGGCTTCCATTCCGGTTTACCTACTCGAGTAGGTAAACCGGAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014613.2-723s21c1
Sequence:CCGGGCTTTACGAGAGAACACCTATCTCGAGATAGGTGTTCTCTCGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-1214s21c1
Sequence:CCGGCCACGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-827s21c1
Sequence:CCGGCATTAACCAACTGACATTTATCTCGAGATAAATGTCAGTTGGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014613
VALIDATED
FAF2 MISSION shRNA shRNA Plasmid DNA
Fas associated factor family member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-1192s1c1
Sequence:CCGGCCACGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014613.x-1037s1c1
Sequence:CCGGCGGCAGAATTTACAGGAGGAACTCGAGTTCCTCCTGTAAATTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-331s1c1
Sequence:CCGGGCTTCCATTCCGGTTTACCTACTCGAGTAGGTAAACCGGAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-701s1c1
Sequence:CCGGGCTTTACGAGAGAACACCTATCTCGAGATAGGTGTTCTCTCGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-1597s21c1
Sequence:CCGGCGCGCAAGGTTAGCAACAAACCTCGAGGTTTGTTGCTAACCTTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-353s21c1
Sequence:CCGGGCTTCCATTCCGGTTTACCTACTCGAGTAGGTAAACCGGAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014613.2-723s21c1
Sequence:CCGGGCTTTACGAGAGAACACCTATCTCGAGATAGGTGTTCTCTCGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-1214s21c1
Sequence:CCGGCCACGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-827s21c1
Sequence:CCGGCATTAACCAACTGACATTTATCTCGAGATAAATGTCAGTTGGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014613
VALIDATED
FAF2 MISSION shRNA Lentiviral Transduction Particles
Fas associated factor family member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-1192s1c1
Sequence:CCGGCCACGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014613.x-1037s1c1
Sequence:CCGGCGGCAGAATTTACAGGAGGAACTCGAGTTCCTCCTGTAAATTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-331s1c1
Sequence:CCGGGCTTCCATTCCGGTTTACCTACTCGAGTAGGTAAACCGGAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014613.x-701s1c1
Sequence:CCGGGCTTTACGAGAGAACACCTATCTCGAGATAGGTGTTCTCTCGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-1597s21c1
Sequence:CCGGCGCGCAAGGTTAGCAACAAACCTCGAGGTTTGTTGCTAACCTTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-353s21c1
Sequence:CCGGGCTTCCATTCCGGTTTACCTACTCGAGTAGGTAAACCGGAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014613.2-723s21c1
Sequence:CCGGGCTTTACGAGAGAACACCTATCTCGAGATAGGTGTTCTCTCGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-1214s21c1
Sequence:CCGGCCACGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014613.2-827s21c1
Sequence:CCGGCATTAACCAACTGACATTTATCTCGAGATAAATGTCAGTTGGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178397
VALIDATED
FAF2 MISSION shRNA Bacterial Glycerol Stock
Fas associated factor family member 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178397.2-1756s1c1
Sequence:CCGGCCCACAGTTTATGAATAACTTCTCGAGAAGTTATTCATAAACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-244s1c1
Sequence:CCGGCCACAGGATCTACAGCTATGTCTCGAGACATAGCTGTAGATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178397.2-1257s1c1
Sequence:CCGGCCTGTGTTCCTTCAGAGGAATCTCGAGATTCCTCTGAAGGAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178397.2-121s1c1
Sequence:CCGGCCTTGCTTTGGAGCAGCATAACTCGAGTTATGCTGCTCCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-1180s1c1
Sequence:CCGGCCATGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178397.2-3129s1c1
Sequence:CCGGCCTCTTAATCTCTTTCTGTAACTCGAGTTACAGAAAGAGATTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-329s1c1
Sequence:CCGGCGGTTTACCTATTACACGATACTCGAGTATCGTGTAATAGGTAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178397
VALIDATED
FAF2 MISSION shRNA shRNA Plasmid DNA
Fas associated factor family member 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178397.2-1756s1c1
Sequence:CCGGCCCACAGTTTATGAATAACTTCTCGAGAAGTTATTCATAAACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-244s1c1
Sequence:CCGGCCACAGGATCTACAGCTATGTCTCGAGACATAGCTGTAGATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178397.2-1257s1c1
Sequence:CCGGCCTGTGTTCCTTCAGAGGAATCTCGAGATTCCTCTGAAGGAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178397.2-121s1c1
Sequence:CCGGCCTTGCTTTGGAGCAGCATAACTCGAGTTATGCTGCTCCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-1180s1c1
Sequence:CCGGCCATGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178397.2-3129s1c1
Sequence:CCGGCCTCTTAATCTCTTTCTGTAACTCGAGTTACAGAAAGAGATTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-329s1c1
Sequence:CCGGCGGTTTACCTATTACACGATACTCGAGTATCGTGTAATAGGTAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178397
VALIDATED
FAF2 MISSION shRNA Lentiviral Transduction Particles
Fas associated factor family member 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178397.2-1756s1c1
Sequence:CCGGCCCACAGTTTATGAATAACTTCTCGAGAAGTTATTCATAAACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-244s1c1
Sequence:CCGGCCACAGGATCTACAGCTATGTCTCGAGACATAGCTGTAGATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178397.2-1257s1c1
Sequence:CCGGCCTGTGTTCCTTCAGAGGAATCTCGAGATTCCTCTGAAGGAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178397.2-121s1c1
Sequence:CCGGCCTTGCTTTGGAGCAGCATAACTCGAGTTATGCTGCTCCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-1180s1c1
Sequence:CCGGCCATGACTTCTTATTCTCCTTCTCGAGAAGGAGAATAAGAAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178397.2-3129s1c1
Sequence:CCGGCCTCTTAATCTCTTTCTGTAACTCGAGTTACAGAAAGAGATTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178397.2-329s1c1
Sequence:CCGGCGGTTTACCTATTACACGATACTCGAGTATCGTGTAATAGGTAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks