EMAIL THIS PAGE TO A FRIEND

FAH

fumarylacetoacetate hydrolase (fumarylacetoacetase)

55 Gene Product Result for
UniProtKB ID: P16930, B2R9X1, D3DW95
Gene ID:
Human(2184) Summary: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
Mouse(14085) fumarylacetoacetate hydrolase
Rat(29383) fumarylacetoacetate hydrolase
Zebrafish(322372) fumarylacetoacetate hydrolase (fumarylacetoacetase)
dog(610140) fumarylacetoacetate hydrolase (fumarylacetoacetase)
chicken(415482) fumarylacetoacetate hydrolase (fumarylacetoacetase)
Horse(100049804) fumarylacetoacetate hydrolase (fumarylacetoacetase)
cow(508724) fumarylacetoacetate hydrolase (fumarylacetoacetase)
domestic cat(101087485) fumarylacetoacetate hydrolase (fumarylacetoacetase)
sheep(101109216) fumarylacetoacetate hydrolase (fumarylacetoacetase)
naked mole-rat(101706288) fumarylacetoacetate hydrolase (fumarylacetoacetase)
domestic guinea pig(100733549) fumarylacetoacetate hydrolase (fumarylacetoacetase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000137 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000137 Rosetta Predictions human pricing
NM_017181 Rosetta Predictions rat pricing
NM_010176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119925 predicted 756
2 SASI_Hs01_00119926 predicted 493
3 SASI_Hs01_00119928 predicted 603
4 SASI_Hs01_00119929 predicted 447
5 SASI_Hs01_00119930 predicted 937
6 SASI_Hs01_00119931 predicted 586
7 SASI_Hs01_00119932 predicted 784
8 SASI_Hs01_00119933 predicted 989
9 SASI_Hs02_00301946 predicted 254
10 SASI_Hs01_00119934 predicted 409
11 SASI_Hs01_00119927 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059885 predicted 406
2 SASI_Rn01_00059886 predicted 495
3 SASI_Rn01_00059887 predicted 910
4 SASI_Rn01_00059888 predicted 459
5 SASI_Rn02_00261515 predicted 276
6 SASI_Rn01_00059890 predicted 1100
7 SASI_Rn01_00059891 predicted 1185
8 SASI_Rn01_00059892 predicted 227
9 SASI_Rn01_00059893 predicted 525
10 SASI_Rn02_00261516 predicted 230
11 SASI_Rn01_00059889 predicted 636
12 SASI_Rn01_00059894 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089035 predicted 341
2 SASI_Mm02_00317962 predicted 456
3 SASI_Mm01_00089036 predicted 423
4 SASI_Mm01_00089037 predicted 836
5 SASI_Mm01_00089038 predicted 968
6 SASI_Mm01_00089040 predicted 606
7 SASI_Mm01_00089041 predicted 561
8 SASI_Mm01_00089042 predicted 911
9 SASI_Mm01_00089043 predicted 958
10 SASI_Mm01_00089044 predicted 388
11 SASI_Mm01_00089039 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010176
VALIDATED
FAH MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase (fumarylacetoacetase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-680s21c1
Sequence:CCGGACTTACCTGTGGGATACCATGCTCGAGCATGGTATCCCACAGGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-788s21c1
Sequence:CCGGATGGTGCCTGCAGACTCTTAGCTCGAGCTAAGAGTCTGCAGGCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-295s21c1
Sequence:CCGGAGCAACCCAAAGCCACGGATTCTCGAGAATCCGTGGCTTTGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-619s21c1
Sequence:CCGGGCCACCAATGTTGGCATTATGCTCGAGCATAATGCCAACATTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-1153s21c1
Sequence:CCGGGCTACCATCTGCAGGTCTAACCTCGAGGTTAGACCTGCAGATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010176.1-901s1c1
Sequence:CCGGCCAGCCCTACACATTTGATATCTCGAGATATCAAATGTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-217s1c1
Sequence:CCGGCGATGAGACAACTCTCAATAACTCGAGTTATTGAGAGTTGTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010176.1-1027s1c1
Sequence:CCGGCCACTCTGTTAATGGATGCAACTCGAGTTGCATCCATTAACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-522s1c1
Sequence:CCGGCCTCCATTGTGGTATCTGGAACTCGAGTTCCAGATACCACAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-157s1c1
Sequence:CCGGCCTGAGTGTCATTAAACACCTCTCGAGAGGTGTTTAATGACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010176
VALIDATED
FAH MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase (fumarylacetoacetase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-680s21c1
Sequence:CCGGACTTACCTGTGGGATACCATGCTCGAGCATGGTATCCCACAGGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-788s21c1
Sequence:CCGGATGGTGCCTGCAGACTCTTAGCTCGAGCTAAGAGTCTGCAGGCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-295s21c1
Sequence:CCGGAGCAACCCAAAGCCACGGATTCTCGAGAATCCGTGGCTTTGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-619s21c1
Sequence:CCGGGCCACCAATGTTGGCATTATGCTCGAGCATAATGCCAACATTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-1153s21c1
Sequence:CCGGGCTACCATCTGCAGGTCTAACCTCGAGGTTAGACCTGCAGATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010176.1-901s1c1
Sequence:CCGGCCAGCCCTACACATTTGATATCTCGAGATATCAAATGTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-217s1c1
Sequence:CCGGCGATGAGACAACTCTCAATAACTCGAGTTATTGAGAGTTGTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010176.1-1027s1c1
Sequence:CCGGCCACTCTGTTAATGGATGCAACTCGAGTTGCATCCATTAACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-522s1c1
Sequence:CCGGCCTCCATTGTGGTATCTGGAACTCGAGTTCCAGATACCACAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-157s1c1
Sequence:CCGGCCTGAGTGTCATTAAACACCTCTCGAGAGGTGTTTAATGACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010176
VALIDATED
FAH MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase (fumarylacetoacetase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-680s21c1
Sequence:CCGGACTTACCTGTGGGATACCATGCTCGAGCATGGTATCCCACAGGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-788s21c1
Sequence:CCGGATGGTGCCTGCAGACTCTTAGCTCGAGCTAAGAGTCTGCAGGCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-295s21c1
Sequence:CCGGAGCAACCCAAAGCCACGGATTCTCGAGAATCCGTGGCTTTGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-619s21c1
Sequence:CCGGGCCACCAATGTTGGCATTATGCTCGAGCATAATGCCAACATTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010176.4-1153s21c1
Sequence:CCGGGCTACCATCTGCAGGTCTAACCTCGAGGTTAGACCTGCAGATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010176.1-901s1c1
Sequence:CCGGCCAGCCCTACACATTTGATATCTCGAGATATCAAATGTGTAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-217s1c1
Sequence:CCGGCGATGAGACAACTCTCAATAACTCGAGTTATTGAGAGTTGTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010176.1-1027s1c1
Sequence:CCGGCCACTCTGTTAATGGATGCAACTCGAGTTGCATCCATTAACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-522s1c1
Sequence:CCGGCCTCCATTGTGGTATCTGGAACTCGAGTTCCAGATACCACAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010176.1-157s1c1
Sequence:CCGGCCTGAGTGTCATTAAACACCTCTCGAGAGGTGTTTAATGACACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000137
VALIDATED
FAH MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase (fumarylacetoacetase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-185s21c1
Sequence:CCGGCAGCATCATCAAGCACCTCTTCTCGAGAAGAGGTGCTTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-921s21c1
Sequence:CCGGCATGACGAGCCCTACACATTTCTCGAGAAATGTGTAGGGCTCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-299s21c1
Sequence:CCGGGAGAGTGTTCTTGCAGAACTTCTCGAGAAGTTCTGCAAGAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-606s21c1
Sequence:CCGGGACTCTAAGCCTCCCGTATATCTCGAGATATACGGGAGGCTTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-754s21c1
Sequence:CCGGACTGGAGTGCACGAGACATTCCTCGAGGAATGTCTCGTGCACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-990s1c1
Sequence:CCGGGCTACCATATGCAAGTCCAATCTCGAGATTGGACTTGCATATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-299s1c1
Sequence:CCGGGAGAGTGTTCTTGCAGAACTTCTCGAGAAGTTCTGCAAGAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-185s1c1
Sequence:CCGGCAGCATCATCAAGCACCTCTTCTCGAGAAGAGGTGCTTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000137.1-1220s1c1
Sequence:CCGGTGAAGTCATCATAACAGGGTACTCGAGTACCCTGTTATGATGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000137
VALIDATED
FAH MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase (fumarylacetoacetase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-185s21c1
Sequence:CCGGCAGCATCATCAAGCACCTCTTCTCGAGAAGAGGTGCTTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-921s21c1
Sequence:CCGGCATGACGAGCCCTACACATTTCTCGAGAAATGTGTAGGGCTCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-299s21c1
Sequence:CCGGGAGAGTGTTCTTGCAGAACTTCTCGAGAAGTTCTGCAAGAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-606s21c1
Sequence:CCGGGACTCTAAGCCTCCCGTATATCTCGAGATATACGGGAGGCTTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-754s21c1
Sequence:CCGGACTGGAGTGCACGAGACATTCCTCGAGGAATGTCTCGTGCACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-990s1c1
Sequence:CCGGGCTACCATATGCAAGTCCAATCTCGAGATTGGACTTGCATATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-299s1c1
Sequence:CCGGGAGAGTGTTCTTGCAGAACTTCTCGAGAAGTTCTGCAAGAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-185s1c1
Sequence:CCGGCAGCATCATCAAGCACCTCTTCTCGAGAAGAGGTGCTTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000137.1-1220s1c1
Sequence:CCGGTGAAGTCATCATAACAGGGTACTCGAGTACCCTGTTATGATGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000137
VALIDATED
FAH MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase (fumarylacetoacetase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-185s21c1
Sequence:CCGGCAGCATCATCAAGCACCTCTTCTCGAGAAGAGGTGCTTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-921s21c1
Sequence:CCGGCATGACGAGCCCTACACATTTCTCGAGAAATGTGTAGGGCTCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-299s21c1
Sequence:CCGGGAGAGTGTTCTTGCAGAACTTCTCGAGAAGTTCTGCAAGAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-606s21c1
Sequence:CCGGGACTCTAAGCCTCCCGTATATCTCGAGATATACGGGAGGCTTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000137.1-754s21c1
Sequence:CCGGACTGGAGTGCACGAGACATTCCTCGAGGAATGTCTCGTGCACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-990s1c1
Sequence:CCGGGCTACCATATGCAAGTCCAATCTCGAGATTGGACTTGCATATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-299s1c1
Sequence:CCGGGAGAGTGTTCTTGCAGAACTTCTCGAGAAGTTCTGCAAGAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_000137.1-185s1c1
Sequence:CCGGCAGCATCATCAAGCACCTCTTCTCGAGAAGAGGTGCTTGATGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000137.1-1220s1c1
Sequence:CCGGTGAAGTCATCATAACAGGGTACTCGAGTACCCTGTTATGATGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks