EMAIL THIS PAGE TO A FRIEND

FAHD1

fumarylacetoacetate hydrolase domain containing 1

97 Gene Product Result for
Synonyms: C16orf36 YISKL
UniProtKB ID: Q6P587, B1AK40, B1AK41, Q6FIC7, Q96RY1, Q9H0N6
Gene ID:
Mouse(68636) fumarylacetoacetate hydrolase domain containing 1
Rat(302980) fumarylacetoacetate hydrolase domain containing 1
Zebrafish(553762) fumarylacetoacetate hydrolase domain containing 1
domestic cat(101084249) fumarylacetoacetate hydrolase domain containing 1
cow(509273) fumarylacetoacetate hydrolase domain containing 1
dog(490068) fumarylacetoacetate hydrolase domain containing 1
chicken(416538) fumarylacetoacetate hydrolase domain containing 1
domestic guinea pig(100728754) fumarylacetoacetate hydrolase domain containing 1
naked mole-rat(101726287) fumarylacetoacetate hydrolase domain containing 1
sheep(101113379) fumarylacetoacetate hydrolase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164031 MISSION® esiRNA esiRNA targeting mouse Fahd1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018104 Rosetta Predictions human pricing
NM_031208 Rosetta Predictions human pricing
NM_001024991 Rosetta Predictions rat pricing
NM_023480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081879 predicted 388
2 SASI_Hs01_00081880 predicted 394
3 SASI_Hs01_00081881 predicted 283
4 SASI_Hs01_00081882 predicted 276
5 SASI_Hs01_00081883 predicted 306
6 SASI_Hs01_00081884 predicted 397
7 SASI_Hs02_00307016 predicted 320
8 SASI_Hs01_00081885 predicted 395
9 SASI_Hs01_00081886 predicted 389
10 SASI_Hs01_00081887 predicted 340
11 SASI_Hs01_00081888 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040487 predicted 395
2 SASI_Hs01_00040488 predicted 401
3 SASI_Hs01_00040489 predicted 289
4 SASI_Hs01_00040490 predicted 288
5 SASI_Hs01_00040491 predicted 314
6 SASI_Hs01_00040492 predicted 399
7 SASI_Hs02_00358612 predicted 323
8 SASI_Hs01_00040493 predicted 401
9 SASI_Hs01_00040494 predicted 396
10 SASI_Hs01_00040495 predicted 351
11 SASI_Hs01_00040496 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047024 predicted 922
2 SASI_Rn01_00047025 predicted 1084
3 SASI_Rn01_00047026 predicted 916
4 SASI_Rn01_00047027 predicted 925
5 SASI_Rn01_00047028 predicted 730
6 SASI_Rn01_00047029 predicted 911
7 SASI_Rn01_00047030 predicted 253
8 SASI_Rn01_00047031 predicted 376
9 SASI_Rn01_00047032 predicted 645
10 SASI_Rn01_00047033 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327136 predicted 1017
2 SASI_Mm01_00024385 predicted 1177
3 SASI_Mm02_00327137 predicted 282
4 SASI_Mm01_00024386 predicted 1031
5 SASI_Mm01_00024389 predicted 377
6 SASI_Mm02_00327138 predicted 766
7 SASI_Mm01_00024390 predicted 1038
8 SASI_Mm02_00327139 predicted 747
9 SASI_Mm01_00024391 predicted 730
10 SASI_Mm02_00327140 predicted 1068
11 SASI_Mm01_00024382 predicted 438
12 SASI_Mm01_00024383 predicted 900
13 SASI_Mm01_00024384 predicted 742
14 SASI_Mm01_00024387 predicted 336
15 SASI_Mm01_00024388 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031208
VALIDATED
FAHD1 MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-514s1c1
Sequence:CCGGCCCTACATCATCAGCTATGTTCTCGAGAACATAGCTGATGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-547s1c1
Sequence:CCGGACCTTGGAAGAAGGAGATATTCTCGAGAATATCTCCTTCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-294s1c1
Sequence:CCGGCTATGCCCTGTGCCTGGATATCTCGAGATATCCAGGCACAGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-525s1c1
Sequence:CCGGCAGCTATGTTTCTAAGATCATCTCGAGATGATCTTAGAAACATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-639s1c1
Sequence:CCGGGCTGGTCAGTATGACATTTAACTCGAGTTAAATGTCATACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031208
VALIDATED
FAHD1 MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-514s1c1
Sequence:CCGGCCCTACATCATCAGCTATGTTCTCGAGAACATAGCTGATGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-547s1c1
Sequence:CCGGACCTTGGAAGAAGGAGATATTCTCGAGAATATCTCCTTCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-294s1c1
Sequence:CCGGCTATGCCCTGTGCCTGGATATCTCGAGATATCCAGGCACAGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-525s1c1
Sequence:CCGGCAGCTATGTTTCTAAGATCATCTCGAGATGATCTTAGAAACATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-639s1c1
Sequence:CCGGGCTGGTCAGTATGACATTTAACTCGAGTTAAATGTCATACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031208
VALIDATED
FAHD1 MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-514s1c1
Sequence:CCGGCCCTACATCATCAGCTATGTTCTCGAGAACATAGCTGATGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-547s1c1
Sequence:CCGGACCTTGGAAGAAGGAGATATTCTCGAGAATATCTCCTTCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-294s1c1
Sequence:CCGGCTATGCCCTGTGCCTGGATATCTCGAGATATCCAGGCACAGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-525s1c1
Sequence:CCGGCAGCTATGTTTCTAAGATCATCTCGAGATGATCTTAGAAACATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_031208.1-639s1c1
Sequence:CCGGGCTGGTCAGTATGACATTTAACTCGAGTTAAATGTCATACTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023480
VALIDATED
FAHD1 MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023480.1-629s1c1
Sequence:CCGGGAGTTGGGCCAATTAAAGAAACTCGAGTTTCTTTAATTGGCCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023480.1-117s1c1
Sequence:CCGGGAGGAACTATGCAGATCACGTCTCGAGACGTGATCTGCATAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023480.1-120s1c1
Sequence:CCGGGAACTATGCAGATCACGTCAACTCGAGTTGACGTGATCTGCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023480.1-881s1c1
Sequence:CCGGGCTAAAGGATATAGAATGCTTCTCGAGAAGCATTCTATATCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023480.1-1018s1c1
Sequence:CCGGGCAAAGGAAGTAACTCATTAACTCGAGTTAATGAGTTACTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023480.1-558s1c1
Sequence:CCGGCATCATCAGCTATGTTTCTAACTCGAGTTAGAAACATAGCTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-286s21c1
Sequence:CCGGGAACTATGCAGATCACGTCAACTCGAGTTGACGTGATCTGCATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-724s21c1
Sequence:CCGGCATCATCAGCTATGTTTCTAACTCGAGTTAGAAACATAGCTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-754s21c1
Sequence:CCGGCTTGGAAGAAGGAGATCTTATCTCGAGATAAGATCTCCTTCTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-1184s21c1
Sequence:CCGGGCAAAGGAAGTAACTCATTAACTCGAGTTAATGAGTTACTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023480
VALIDATED
FAHD1 MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023480.1-629s1c1
Sequence:CCGGGAGTTGGGCCAATTAAAGAAACTCGAGTTTCTTTAATTGGCCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023480.1-117s1c1
Sequence:CCGGGAGGAACTATGCAGATCACGTCTCGAGACGTGATCTGCATAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023480.1-120s1c1
Sequence:CCGGGAACTATGCAGATCACGTCAACTCGAGTTGACGTGATCTGCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023480.1-881s1c1
Sequence:CCGGGCTAAAGGATATAGAATGCTTCTCGAGAAGCATTCTATATCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023480.1-1018s1c1
Sequence:CCGGGCAAAGGAAGTAACTCATTAACTCGAGTTAATGAGTTACTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023480.1-558s1c1
Sequence:CCGGCATCATCAGCTATGTTTCTAACTCGAGTTAGAAACATAGCTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-286s21c1
Sequence:CCGGGAACTATGCAGATCACGTCAACTCGAGTTGACGTGATCTGCATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-724s21c1
Sequence:CCGGCATCATCAGCTATGTTTCTAACTCGAGTTAGAAACATAGCTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-754s21c1
Sequence:CCGGCTTGGAAGAAGGAGATCTTATCTCGAGATAAGATCTCCTTCTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-1184s21c1
Sequence:CCGGGCAAAGGAAGTAACTCATTAACTCGAGTTAATGAGTTACTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023480
VALIDATED
FAHD1 MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023480.1-629s1c1
Sequence:CCGGGAGTTGGGCCAATTAAAGAAACTCGAGTTTCTTTAATTGGCCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023480.1-117s1c1
Sequence:CCGGGAGGAACTATGCAGATCACGTCTCGAGACGTGATCTGCATAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023480.1-120s1c1
Sequence:CCGGGAACTATGCAGATCACGTCAACTCGAGTTGACGTGATCTGCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023480.1-881s1c1
Sequence:CCGGGCTAAAGGATATAGAATGCTTCTCGAGAAGCATTCTATATCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023480.1-1018s1c1
Sequence:CCGGGCAAAGGAAGTAACTCATTAACTCGAGTTAATGAGTTACTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023480.1-558s1c1
Sequence:CCGGCATCATCAGCTATGTTTCTAACTCGAGTTAGAAACATAGCTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-286s21c1
Sequence:CCGGGAACTATGCAGATCACGTCAACTCGAGTTGACGTGATCTGCATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-724s21c1
Sequence:CCGGCATCATCAGCTATGTTTCTAACTCGAGTTAGAAACATAGCTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-754s21c1
Sequence:CCGGCTTGGAAGAAGGAGATCTTATCTCGAGATAAGATCTCCTTCTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023480.2-1184s21c1
Sequence:CCGGGCAAAGGAAGTAACTCATTAACTCGAGTTAATGAGTTACTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks