EMAIL THIS PAGE TO A FRIEND

FAHD2A

fumarylacetoacetate hydrolase domain containing 2A

UniProtKB ID: Q96GK7, Q9Y3B0
Gene ID:
Mouse(68126) fumarylacetoacetate hydrolase domain containing 2A
Rat(296131) fumarylacetoacetate hydrolase domain containing 2A
naked mole-rat(101700516) fumarylacetoacetate hydrolase domain containing 2A
domestic guinea pig(100731203) fumarylacetoacetate hydrolase domain containing 2A
Zebrafish(405854) fumarylacetoacetate hydrolase domain containing 2A
chicken(426684) fumarylacetoacetate hydrolase domain containing 2A
cow(404123) fumarylacetoacetate hydrolase domain containing 2A
domestic cat(101087731) fumarylacetoacetate hydrolase domain containing 2A
dog(475745) fumarylacetoacetate hydrolase domain containing 2A
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048611 MISSION® esiRNA esiRNA targeting mouse Fahd2a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016044 Rosetta Predictions human pricing
NM_001134834 Rosetta Predictions rat pricing
NM_029629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094538 predicted 758
2 SASI_Hs01_00094539 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258624 predicted 451
2 SASI_Rn02_00258625 predicted 852
3 SASI_Rn02_00258626 predicted 500
4 SASI_Rn02_00258627 predicted 941
5 SASI_Rn02_00258628 predicted 471
6 SASI_Rn02_00258629 predicted 382
7 SASI_Rn02_00258630 predicted 742
8 SASI_Rn02_00258631 predicted 610
9 SASI_Rn02_00258632 predicted 724
10 SASI_Rn02_00258633 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133322 predicted 947
2 SASI_Mm01_00133323 predicted 250
3 SASI_Mm02_00335621 predicted 796
4 SASI_Mm01_00133324 predicted 854
5 SASI_Mm01_00133325 predicted 402
6 SASI_Mm01_00133326 predicted 418
7 SASI_Mm02_00335622 predicted 848
8 SASI_Mm01_00133327 predicted 298
9 SASI_Mm01_00133328 predicted 689
10 SASI_Mm01_00133329 predicted 575
11 SASI_Mm01_00133330 predicted 603
12 SASI_Mm01_00133331 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016044
VALIDATED
FAHD2A MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase domain containing 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-479s21c1
Sequence:CCGGTCCAGTCACACGACCAGATAACTCGAGTTATCTGGTCGTGTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-632s21c1
Sequence:CCGGACAGAGCCAGGAGGTAGATTGCTCGAGCAATCTACCTCCTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-762s21c1
Sequence:CCGGGACTGGCAAATGAGACGTAATCTCGAGATTACGTCTCATTTGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-880s21c1
Sequence:CCGGAGATCTGCTGCCGAGTGAATGCTCGAGCATTCACTCGGCAGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-758s1c1
Sequence:CCGGGTGACTGGCAAATGAGACGTACTCGAGTACGTCTCATTTGCCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016044.1-664s1c1
Sequence:CCGGGCCGTGGTCATTGGAAAGAAACTCGAGTTTCTTTCCAATGACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-765s1c1
Sequence:CCGGGCAAATGAGACGTAATGGGAACTCGAGTTCCCATTACGTCTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-565s1c1
Sequence:CCGGCCCATCATCTTCAGCAAGTTTCTCGAGAAACTTGCTGAAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016044
VALIDATED
FAHD2A MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase domain containing 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-479s21c1
Sequence:CCGGTCCAGTCACACGACCAGATAACTCGAGTTATCTGGTCGTGTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-632s21c1
Sequence:CCGGACAGAGCCAGGAGGTAGATTGCTCGAGCAATCTACCTCCTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-762s21c1
Sequence:CCGGGACTGGCAAATGAGACGTAATCTCGAGATTACGTCTCATTTGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-880s21c1
Sequence:CCGGAGATCTGCTGCCGAGTGAATGCTCGAGCATTCACTCGGCAGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-758s1c1
Sequence:CCGGGTGACTGGCAAATGAGACGTACTCGAGTACGTCTCATTTGCCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016044.1-664s1c1
Sequence:CCGGGCCGTGGTCATTGGAAAGAAACTCGAGTTTCTTTCCAATGACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-765s1c1
Sequence:CCGGGCAAATGAGACGTAATGGGAACTCGAGTTCCCATTACGTCTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-565s1c1
Sequence:CCGGCCCATCATCTTCAGCAAGTTTCTCGAGAAACTTGCTGAAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016044
VALIDATED
FAHD2A MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase domain containing 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-479s21c1
Sequence:CCGGTCCAGTCACACGACCAGATAACTCGAGTTATCTGGTCGTGTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-632s21c1
Sequence:CCGGACAGAGCCAGGAGGTAGATTGCTCGAGCAATCTACCTCCTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-762s21c1
Sequence:CCGGGACTGGCAAATGAGACGTAATCTCGAGATTACGTCTCATTTGCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016044.2-880s21c1
Sequence:CCGGAGATCTGCTGCCGAGTGAATGCTCGAGCATTCACTCGGCAGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-758s1c1
Sequence:CCGGGTGACTGGCAAATGAGACGTACTCGAGTACGTCTCATTTGCCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016044.1-664s1c1
Sequence:CCGGGCCGTGGTCATTGGAAAGAAACTCGAGTTTCTTTCCAATGACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-765s1c1
Sequence:CCGGGCAAATGAGACGTAATGGGAACTCGAGTTCCCATTACGTCTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016044.1-565s1c1
Sequence:CCGGCCCATCATCTTCAGCAAGTTTCTCGAGAAACTTGCTGAAGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026568
FAHD2A MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase domain containing 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-874s1c1
Sequence:CCGGCACCAACCAGATGGTGTTCAACTCGAGTTGAACACCATCTGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-807s1c1
Sequence:CCGGCCATAGCAGATCCACACAATTCTCGAGAATTGTGTGGATCTGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-785s1c1
Sequence:CCGGCCTGCCTTGGTTACCAAGGATCTCGAGATCCTTGGTAACCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-882s1c1
Sequence:CCGGAGATGGTGTTCAAGACTGAATCTCGAGATTCAGTCTTGAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-718s1c1
Sequence:CCGGCTGGCAAATGAGAAATGGAAACTCGAGTTTCCATTTCTCATTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026568
FAHD2A MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase domain containing 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-874s1c1
Sequence:CCGGCACCAACCAGATGGTGTTCAACTCGAGTTGAACACCATCTGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-807s1c1
Sequence:CCGGCCATAGCAGATCCACACAATTCTCGAGAATTGTGTGGATCTGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-785s1c1
Sequence:CCGGCCTGCCTTGGTTACCAAGGATCTCGAGATCCTTGGTAACCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-882s1c1
Sequence:CCGGAGATGGTGTTCAAGACTGAATCTCGAGATTCAGTCTTGAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-718s1c1
Sequence:CCGGCTGGCAAATGAGAAATGGAAACTCGAGTTTCCATTTCTCATTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026568
FAHD2A MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase domain containing 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-874s1c1
Sequence:CCGGCACCAACCAGATGGTGTTCAACTCGAGTTGAACACCATCTGGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-807s1c1
Sequence:CCGGCCATAGCAGATCCACACAATTCTCGAGAATTGTGTGGATCTGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-785s1c1
Sequence:CCGGCCTGCCTTGGTTACCAAGGATCTCGAGATCCTTGGTAACCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-882s1c1
Sequence:CCGGAGATGGTGTTCAAGACTGAATCTCGAGATTCAGTCTTGAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026568.1-718s1c1
Sequence:CCGGCTGGCAAATGAGAAATGGAAACTCGAGTTTCCATTTCTCATTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks