EMAIL THIS PAGE TO A FRIEND

FAHD2B

fumarylacetoacetate hydrolase domain containing 2B

8 Gene Product Result for
Species: Human FAHD2B(151313)
UniProtKB ID: Q6P2I3, D3DXH7, Q8NDK1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199336 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199336 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211389 predicted 731
2 SASI_Hs01_00211390 predicted 451
3 SASI_Hs01_00211391 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199336
FAHD2B MISSION shRNA Bacterial Glycerol Stock
fumarylacetoacetate hydrolase domain containing 2B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1057s1c1
Sequence:CCGGGATTGAAGAACTAGGTGTCATCTCGAGATGACACCTAGTTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-1049s1c1
Sequence:CCGGCAGTGTGAGATTGAAGAACTACTCGAGTAGTTCTTCAATCTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-486s1c1
Sequence:CCGGGCATGAATTATGTGGACCACTCTCGAGAGTGGTCCACATAATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1040s1c1
Sequence:CCGGGATGAAGTCCAGTGTGAGATTCTCGAGAATCTCACACTGGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-502s1c1
Sequence:CCGGCCACTGCAAAGAACAGAACGTCTCGAGACGTTCTGTTCTTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-739s1c1
Sequence:CCGGGCTAACAAGACGCAATGGGAACTCGAGTTCCCATTGCGTCTTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-998s1c1
Sequence:CCGGGTCGGTGTATTCAGGAAACCTCTCGAGAGGTTTCCTGAATACACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-892s1c1
Sequence:CCGGCAACACCAACCAGATGGTATTCTCGAGAATACCATCTGGTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1048s1c1
Sequence:CCGGCCAGTGTGAGATTGAAGAACTCTCGAGAGTTCTTCAATCTCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199336
FAHD2B MISSION shRNA shRNA Plasmid DNA
fumarylacetoacetate hydrolase domain containing 2B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1057s1c1
Sequence:CCGGGATTGAAGAACTAGGTGTCATCTCGAGATGACACCTAGTTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-1049s1c1
Sequence:CCGGCAGTGTGAGATTGAAGAACTACTCGAGTAGTTCTTCAATCTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-486s1c1
Sequence:CCGGGCATGAATTATGTGGACCACTCTCGAGAGTGGTCCACATAATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1040s1c1
Sequence:CCGGGATGAAGTCCAGTGTGAGATTCTCGAGAATCTCACACTGGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-502s1c1
Sequence:CCGGCCACTGCAAAGAACAGAACGTCTCGAGACGTTCTGTTCTTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-739s1c1
Sequence:CCGGGCTAACAAGACGCAATGGGAACTCGAGTTCCCATTGCGTCTTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-998s1c1
Sequence:CCGGGTCGGTGTATTCAGGAAACCTCTCGAGAGGTTTCCTGAATACACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-892s1c1
Sequence:CCGGCAACACCAACCAGATGGTATTCTCGAGAATACCATCTGGTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1048s1c1
Sequence:CCGGCCAGTGTGAGATTGAAGAACTCTCGAGAGTTCTTCAATCTCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199336
FAHD2B MISSION shRNA Lentiviral Transduction Particles
fumarylacetoacetate hydrolase domain containing 2B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1057s1c1
Sequence:CCGGGATTGAAGAACTAGGTGTCATCTCGAGATGACACCTAGTTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-1049s1c1
Sequence:CCGGCAGTGTGAGATTGAAGAACTACTCGAGTAGTTCTTCAATCTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-486s1c1
Sequence:CCGGGCATGAATTATGTGGACCACTCTCGAGAGTGGTCCACATAATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1040s1c1
Sequence:CCGGGATGAAGTCCAGTGTGAGATTCTCGAGAATCTCACACTGGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-502s1c1
Sequence:CCGGCCACTGCAAAGAACAGAACGTCTCGAGACGTTCTGTTCTTTGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-739s1c1
Sequence:CCGGGCTAACAAGACGCAATGGGAACTCGAGTTCCCATTGCGTCTTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-998s1c1
Sequence:CCGGGTCGGTGTATTCAGGAAACCTCTCGAGAGGTTTCCTGAATACACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199336.1-892s1c1
Sequence:CCGGCAACACCAACCAGATGGTATTCTCGAGAATACCATCTGGTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199336.1-1048s1c1
Sequence:CCGGCCAGTGTGAGATTGAAGAACTCTCGAGAGTTCTTCAATCTCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks