EMAIL THIS PAGE TO A FRIEND

FAIM2

Fas apoptotic inhibitory molecule 2

63 Gene Product Result for
Synonyms: LFG LFG2 NGP35 NMP35 TMBIM2
UniProtKB ID: Q9BWQ8, A8K1W6, Q9UJY9, Q9Y2F7
Gene ID:
Mouse(72393) Fas apoptotic inhibitory molecule 2
Rat(246274) Fas apoptotic inhibitory molecule 2
sheep(101121759) Fas apoptotic inhibitory molecule 2
naked mole-rat(101707310) Fas apoptotic inhibitory molecule 2
domestic guinea pig(100722287) Fas apoptotic inhibitory molecule 2
chicken(426899) Fas apoptotic inhibitory molecule 2
domestic cat(101085220) Fas apoptotic inhibitory molecule 2
cow(509790) Fas apoptotic inhibitory molecule 2
dog(477613) Fas apoptotic inhibitory molecule 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012306 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012306 Rosetta Predictions human pricing
NM_144756 Rosetta Predictions rat pricing
NM_001038658 Rosetta Predictions mouse pricing
NM_028224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217839 predicted 1017
2 SASI_Hs01_00217840 predicted 822
3 SASI_Hs01_00217841 predicted 645
4 SASI_Hs01_00217842 predicted 1544
5 SASI_Hs02_00344077 predicted 579
6 SASI_Hs01_00217843 predicted 1384
7 SASI_Hs01_00217844 predicted 1277
8 SASI_Hs01_00217846 predicted 460
9 SASI_Hs01_00217847 predicted 1270
10 SASI_Hs01_00217848 predicted 435
11 SASI_Hs01_00217845 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061593 predicted 529
2 SASI_Rn01_00061594 predicted 296
3 SASI_Rn01_00061595 predicted 501
4 SASI_Rn01_00061596 predicted 495
5 SASI_Rn01_00061597 predicted 573
6 SASI_Rn01_00061598 predicted 690
7 SASI_Rn01_00061599 predicted 745
8 SASI_Rn01_00061600 predicted 451
9 SASI_Rn02_00268644 predicted 443
10 SASI_Rn02_00268645 predicted 764
11 SASI_Rn01_00061601 predicted 423
12 SASI_Rn01_00061602 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043124 predicted 1619
2 SASI_Mm01_00043125 predicted 1708
3 SASI_Mm01_00043126 predicted 1276
4 SASI_Mm01_00043127 predicted 889
5 SASI_Mm01_00043128 predicted 1811
6 SASI_Mm01_00043129 predicted 1262
7 SASI_Mm01_00043130 predicted 1566
8 SASI_Mm01_00043131 predicted 1522
9 SASI_Mm01_00043132 predicted 1184
10 SASI_Mm01_00043133 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200890 predicted 1653
2 SASI_Mm01_00200891 predicted 1748
3 SASI_Mm01_00200892 predicted 1311
4 SASI_Mm01_00200893 predicted 925
5 SASI_Mm01_00200894 predicted 1840
6 SASI_Mm01_00200895 predicted 1305
7 SASI_Mm01_00200896 predicted 1608
8 SASI_Mm01_00200897 predicted 1557
9 SASI_Mm01_00200898 predicted 1217
10 SASI_Mm01_00200899 predicted 1443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012306
FAIM2 MISSION shRNA Bacterial Glycerol Stock
Fas apoptotic inhibitory molecule 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012306.2-921s21c1
Sequence:CCGGCACTGGGAGCGGGTGTATTTACTCGAGTAAATACACCCGCTCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012306.2-525s21c1
Sequence:CCGGGTGACCCTGTCAAGGACTATGCTCGAGCATAGTCCTTGACAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-4127s1c1
Sequence:CCGGCCGGAATCTTAGTTCTTCCATCTCGAGATGGAAGAACTAAGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-4128s1c1
Sequence:CCGGCGGAATCTTAGTTCTTCCATTCTCGAGAATGGAAGAACTAAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012306.2-904s1c1
Sequence:CCGGCCATGCAGTTTATGCAGCACTCTCGAGAGTGCTGCATAAACTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012306.2-784s1c1
Sequence:CCGGCTTCCAGACCAAGTTCGACTTCTCGAGAAGTCGAACTTGGTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012306.2-430s1c1
Sequence:CCGGCCAGAAAGTTCGTCGAGTCTTCTCGAGAAGACTCGACGAACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012306.2-461s1c1
Sequence:CCGGGTCTACACCATCCTGCTGATTCTCGAGAATCAGCAGGATGGTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-3217s1c1
Sequence:CCGGCCTGCTATTAGGTGAGGGTTTCTCGAGAAACCCTCACCTAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012306
FAIM2 MISSION shRNA shRNA Plasmid DNA
Fas apoptotic inhibitory molecule 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012306.2-921s21c1
Sequence:CCGGCACTGGGAGCGGGTGTATTTACTCGAGTAAATACACCCGCTCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012306.2-525s21c1
Sequence:CCGGGTGACCCTGTCAAGGACTATGCTCGAGCATAGTCCTTGACAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-4127s1c1
Sequence:CCGGCCGGAATCTTAGTTCTTCCATCTCGAGATGGAAGAACTAAGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-4128s1c1
Sequence:CCGGCGGAATCTTAGTTCTTCCATTCTCGAGAATGGAAGAACTAAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012306.2-904s1c1
Sequence:CCGGCCATGCAGTTTATGCAGCACTCTCGAGAGTGCTGCATAAACTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012306.2-784s1c1
Sequence:CCGGCTTCCAGACCAAGTTCGACTTCTCGAGAAGTCGAACTTGGTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012306.2-430s1c1
Sequence:CCGGCCAGAAAGTTCGTCGAGTCTTCTCGAGAAGACTCGACGAACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012306.2-461s1c1
Sequence:CCGGGTCTACACCATCCTGCTGATTCTCGAGAATCAGCAGGATGGTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-3217s1c1
Sequence:CCGGCCTGCTATTAGGTGAGGGTTTCTCGAGAAACCCTCACCTAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012306
FAIM2 MISSION shRNA Lentiviral Transduction Particles
Fas apoptotic inhibitory molecule 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012306.2-921s21c1
Sequence:CCGGCACTGGGAGCGGGTGTATTTACTCGAGTAAATACACCCGCTCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012306.2-525s21c1
Sequence:CCGGGTGACCCTGTCAAGGACTATGCTCGAGCATAGTCCTTGACAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-4127s1c1
Sequence:CCGGCCGGAATCTTAGTTCTTCCATCTCGAGATGGAAGAACTAAGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-4128s1c1
Sequence:CCGGCGGAATCTTAGTTCTTCCATTCTCGAGAATGGAAGAACTAAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012306.2-904s1c1
Sequence:CCGGCCATGCAGTTTATGCAGCACTCTCGAGAGTGCTGCATAAACTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012306.2-784s1c1
Sequence:CCGGCTTCCAGACCAAGTTCGACTTCTCGAGAAGTCGAACTTGGTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012306.2-430s1c1
Sequence:CCGGCCAGAAAGTTCGTCGAGTCTTCTCGAGAAGACTCGACGAACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012306.2-461s1c1
Sequence:CCGGGTCTACACCATCCTGCTGATTCTCGAGAATCAGCAGGATGGTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012306.2-3217s1c1
Sequence:CCGGCCTGCTATTAGGTGAGGGTTTCTCGAGAAACCCTCACCTAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028224
FAIM2 MISSION shRNA Bacterial Glycerol Stock
Fas apoptotic inhibitory molecule 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028224.3-1308s1c1
Sequence:CCGGCAACATCTACTTAGACATTATCTCGAGATAATGTCTAAGTAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028224.3-933s1c1
Sequence:CCGGGATTCTGCTGACCATCTTTACCTCGAGGTAAAGATGGTCAGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-718s1c1
Sequence:CCGGCATCTTCAGTTTCCAGACCAACTCGAGTTGGTCTGGAAACTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-399s1c1
Sequence:CCGGGAAAGGTCTATACCATCCTATCTCGAGATAGGATGGTATAGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028224.2-1199s1c1
Sequence:CCGGGCTTGTACATATGCCATGCTTCTCGAGAAGCATGGCATATGTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-648s1c1
Sequence:CCGGCCAGTTACTACAACACCACATCTCGAGATGTGGTGTTGTAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028224.2-1276s1c1
Sequence:CCGGGCATCTTCCAAATGGCACAGTCTCGAGACTGTGCCATTTGGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028224
FAIM2 MISSION shRNA shRNA Plasmid DNA
Fas apoptotic inhibitory molecule 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028224.3-1308s1c1
Sequence:CCGGCAACATCTACTTAGACATTATCTCGAGATAATGTCTAAGTAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028224.3-933s1c1
Sequence:CCGGGATTCTGCTGACCATCTTTACCTCGAGGTAAAGATGGTCAGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-718s1c1
Sequence:CCGGCATCTTCAGTTTCCAGACCAACTCGAGTTGGTCTGGAAACTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-399s1c1
Sequence:CCGGGAAAGGTCTATACCATCCTATCTCGAGATAGGATGGTATAGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028224.2-1199s1c1
Sequence:CCGGGCTTGTACATATGCCATGCTTCTCGAGAAGCATGGCATATGTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-648s1c1
Sequence:CCGGCCAGTTACTACAACACCACATCTCGAGATGTGGTGTTGTAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028224.2-1276s1c1
Sequence:CCGGGCATCTTCCAAATGGCACAGTCTCGAGACTGTGCCATTTGGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028224
FAIM2 MISSION shRNA Lentiviral Transduction Particles
Fas apoptotic inhibitory molecule 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028224.3-1308s1c1
Sequence:CCGGCAACATCTACTTAGACATTATCTCGAGATAATGTCTAAGTAGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028224.3-933s1c1
Sequence:CCGGGATTCTGCTGACCATCTTTACCTCGAGGTAAAGATGGTCAGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-718s1c1
Sequence:CCGGCATCTTCAGTTTCCAGACCAACTCGAGTTGGTCTGGAAACTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-399s1c1
Sequence:CCGGGAAAGGTCTATACCATCCTATCTCGAGATAGGATGGTATAGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028224.2-1199s1c1
Sequence:CCGGGCTTGTACATATGCCATGCTTCTCGAGAAGCATGGCATATGTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028224.2-648s1c1
Sequence:CCGGCCAGTTACTACAACACCACATCTCGAGATGTGGTGTTGTAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028224.2-1276s1c1
Sequence:CCGGGCATCTTCCAAATGGCACAGTCTCGAGACTGTGCCATTTGGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks