EMAIL THIS PAGE TO A FRIEND

FAIM3

Fas apoptotic inhibitory molecule 3

96 Gene Product Result for
Synonyms: FCMR TOSO
UniProtKB ID: O60667, A8K7J2, B7Z6Z0, D9MWM3
Gene ID:
Human(9214) Summary: Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]
Mouse(69169) Fas apoptotic inhibitory molecule 3
Rat(548326) Fas apoptotic inhibitory molecule 3
dog(490266) Fas apoptotic inhibitory molecule 3
domestic cat(101095632) Fas apoptotic inhibitory molecule 3
cow(511564) Fas apoptotic inhibitory molecule 3
domestic guinea pig(100715061) Fas apoptotic inhibitory molecule 3
naked mole-rat(101706816) Fas apoptotic inhibitory molecule 3
sheep(101113690) Fas apoptotic inhibitory molecule 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005449 Rosetta Predictions human pricing
NM_001014843 Rosetta Predictions rat pricing
NM_026976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082848 predicted 376
2 SASI_Hs01_00082850 predicted 493
3 SASI_Hs01_00082852 predicted 362
4 SASI_Hs01_00082854 predicted 593
5 SASI_Hs02_00339608 predicted 593
6 SASI_Hs01_00082855 predicted 389
7 SASI_Hs02_00339609 predicted 412
8 SASI_Hs01_00082856 predicted 422
9 SASI_Hs01_00082857 predicted 625
10 SASI_Hs02_00339610 predicted 398
11 SASI_Hs01_00082849 predicted 1616
12 SASI_Hs01_00082851 predicted 564
13 SASI_Hs01_00082853 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119702 predicted 367
2 SASI_Rn01_00119703 predicted 226
3 SASI_Rn02_00201908 predicted 367
4 SASI_Rn01_00119706 predicted 454
5 SASI_Rn01_00119707 predicted 1227
6 SASI_Rn02_00201909 predicted 680
7 SASI_Rn01_00119708 predicted 594
8 SASI_Rn01_00119709 predicted 468
9 SASI_Rn01_00119710 predicted 343
10 SASI_Rn01_00119711 predicted 848
11 SASI_Rn01_00119704 predicted 216
12 SASI_Rn01_00119705 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166976 predicted 216
2 SASI_Mm01_00166977 predicted 575
3 SASI_Mm01_00166978 predicted 402
4 SASI_Mm01_00166980 predicted 436
5 SASI_Mm01_00166981 predicted 1263
6 SASI_Mm01_00166982 predicted 196
7 SASI_Mm02_00331296 predicted 1263
8 SASI_Mm02_00331297 predicted 431
9 SASI_Mm01_00166983 predicted 204
10 SASI_Mm01_00166984 predicted 278
11 SASI_Mm01_00166979 predicted 504
12 SASI_Mm01_00166985 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005449
FAIM3 MISSION shRNA Bacterial Glycerol Stock
Fas apoptotic inhibitory molecule 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-388s1c1
Sequence:CCGGCCACGCAAGAATCTGTTCCTACTCGAGTAGGAACAGATTCTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-353s1c1
Sequence:CCGGCAGAATACAAGGGCCGAGTTACTCGAGTAACTCGGCCCTTGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005449.3-1384s1c1
Sequence:CCGGGATGTCCAATACCTGCTTCATCTCGAGATGAAGCAGGTATTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-605s1c1
Sequence:CCGGCCAGTTCTTCCAAATTCGTAACTCGAGTTACGAATTTGGAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-262s1c1
Sequence:CCGGCCTGAAATGCATGTGAGGATACTCGAGTATCCTCACATGCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005449.4-1755s21c1
Sequence:CCGGAGGGTTGGGTCTTACACAAATCTCGAGATTTGTGTAAGACCCAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005449.4-600s21c1
Sequence:CCGGTGGTTTCATCTGCCCTATTTGCTCGAGCAAATAGGGCAGATGAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005449
FAIM3 MISSION shRNA shRNA Plasmid DNA
Fas apoptotic inhibitory molecule 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-388s1c1
Sequence:CCGGCCACGCAAGAATCTGTTCCTACTCGAGTAGGAACAGATTCTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-353s1c1
Sequence:CCGGCAGAATACAAGGGCCGAGTTACTCGAGTAACTCGGCCCTTGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005449.3-1384s1c1
Sequence:CCGGGATGTCCAATACCTGCTTCATCTCGAGATGAAGCAGGTATTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-605s1c1
Sequence:CCGGCCAGTTCTTCCAAATTCGTAACTCGAGTTACGAATTTGGAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-262s1c1
Sequence:CCGGCCTGAAATGCATGTGAGGATACTCGAGTATCCTCACATGCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005449.4-1755s21c1
Sequence:CCGGAGGGTTGGGTCTTACACAAATCTCGAGATTTGTGTAAGACCCAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005449.4-600s21c1
Sequence:CCGGTGGTTTCATCTGCCCTATTTGCTCGAGCAAATAGGGCAGATGAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005449
FAIM3 MISSION shRNA Lentiviral Transduction Particles
Fas apoptotic inhibitory molecule 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-388s1c1
Sequence:CCGGCCACGCAAGAATCTGTTCCTACTCGAGTAGGAACAGATTCTTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-353s1c1
Sequence:CCGGCAGAATACAAGGGCCGAGTTACTCGAGTAACTCGGCCCTTGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005449.3-1384s1c1
Sequence:CCGGGATGTCCAATACCTGCTTCATCTCGAGATGAAGCAGGTATTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-605s1c1
Sequence:CCGGCCAGTTCTTCCAAATTCGTAACTCGAGTTACGAATTTGGAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005449.3-262s1c1
Sequence:CCGGCCTGAAATGCATGTGAGGATACTCGAGTATCCTCACATGCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005449.4-1755s21c1
Sequence:CCGGAGGGTTGGGTCTTACACAAATCTCGAGATTTGTGTAAGACCCAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005449.4-600s21c1
Sequence:CCGGTGGTTTCATCTGCCCTATTTGCTCGAGCAAATAGGGCAGATGAAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026976
FAIM3 MISSION shRNA Bacterial Glycerol Stock
Fas apoptotic inhibitory molecule 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-236s1c1
Sequence:CCGGAGATGGCCAAACCTGGGATATCTCGAGATATCCCAGGTTTGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-201s1c1
Sequence:CCGGCCCTCAACTACACGTAAGGATCTCGAGATCCTTACGTGTAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-437s1c1
Sequence:CCGGCCCTGAATGTCCATAATGAATCTCGAGATTCATTATGGACATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-865s1c1
Sequence:CCGGCCAGAATTTCACATCCTGATTCTCGAGAATCAGGATGTGAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-661s1c1
Sequence:CCGGCCCAGAGTTTACAGAGCATTTCTCGAGAAATGCTCTGTAAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026976
FAIM3 MISSION shRNA shRNA Plasmid DNA
Fas apoptotic inhibitory molecule 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-236s1c1
Sequence:CCGGAGATGGCCAAACCTGGGATATCTCGAGATATCCCAGGTTTGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-201s1c1
Sequence:CCGGCCCTCAACTACACGTAAGGATCTCGAGATCCTTACGTGTAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-437s1c1
Sequence:CCGGCCCTGAATGTCCATAATGAATCTCGAGATTCATTATGGACATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-865s1c1
Sequence:CCGGCCAGAATTTCACATCCTGATTCTCGAGAATCAGGATGTGAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-661s1c1
Sequence:CCGGCCCAGAGTTTACAGAGCATTTCTCGAGAAATGCTCTGTAAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026976
FAIM3 MISSION shRNA Lentiviral Transduction Particles
Fas apoptotic inhibitory molecule 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-236s1c1
Sequence:CCGGAGATGGCCAAACCTGGGATATCTCGAGATATCCCAGGTTTGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-201s1c1
Sequence:CCGGCCCTCAACTACACGTAAGGATCTCGAGATCCTTACGTGTAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-437s1c1
Sequence:CCGGCCCTGAATGTCCATAATGAATCTCGAGATTCATTATGGACATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-865s1c1
Sequence:CCGGCCAGAATTTCACATCCTGATTCTCGAGAATCAGGATGTGAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026976.1-661s1c1
Sequence:CCGGCCCAGAGTTTACAGAGCATTTCTCGAGAAATGCTCTGTAAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks