EMAIL THIS PAGE TO A FRIEND

FAIM

Fas apoptotic inhibitory molecule

108 Gene Product Result for
Synonyms: FAIM1
UniProtKB ID: Q9NVQ4, Q6IAN2
Gene ID:
Human(55179) Summary: The protein encoded by this gene protects against death receptor-triggered apoptosis and regulates B-cell signaling and differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(23873) Fas apoptotic inhibitory molecule
Rat(140930) Fas apoptotic inhibitory molecule
chicken(424270) Fas apoptotic inhibitory molecule
cow(616795) Fas apoptotic inhibitory molecule
domestic cat(101092137) Fas apoptotic inhibitory molecule
dog(485687) Fas apoptotic inhibitory molecule
domestic guinea pig(100727709) Fas apoptotic inhibitory molecule
naked mole-rat(101713493) Fas apoptotic inhibitory molecule
sheep(101110017) Fas apoptotic inhibitory molecule
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001122851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001122851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001122851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033030 Rosetta Predictions human pricing
NM_001033031 Rosetta Predictions human pricing
NM_001033032 Rosetta Predictions human pricing
NM_018147 Rosetta Predictions human pricing
NM_080895 Rosetta Predictions rat pricing
NM_001122851 Rosetta Predictions mouse pricing
NM_011810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100261 predicted 1002
2 SASI_Hs01_00100262 predicted 975
3 SASI_Hs02_00307971 predicted 1041
4 SASI_Hs01_00100264 predicted 1070
5 SASI_Hs01_00100265 predicted 1208
6 SASI_Hs01_00100266 predicted 1244
7 SASI_Hs01_00100267 predicted 1124
8 SASI_Hs01_00100268 predicted 1171
9 SASI_Hs01_00100269 predicted 1146
10 SASI_Hs01_00100270 predicted 1172
11 SASI_Hs01_00100263 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119307 predicted 623
2 SASI_Hs01_00119308 predicted 603
3 SASI_Hs02_00307972 predicted 659
4 SASI_Hs01_00119310 predicted 699
5 SASI_Hs01_00119311 predicted 833
6 SASI_Hs01_00119312 predicted 870
7 SASI_Hs01_00119313 predicted 753
8 SASI_Hs01_00119314 predicted 803
9 SASI_Hs01_00119315 predicted 771
10 SASI_Hs01_00119316 predicted 794
11 SASI_Hs01_00119309 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192124 predicted 559
2 SASI_Hs01_00192125 predicted 537
3 SASI_Hs02_00307973 predicted 599
4 SASI_Hs01_00192127 predicted 635
5 SASI_Hs01_00192128 predicted 781
6 SASI_Hs01_00192129 predicted 808
7 SASI_Hs01_00192130 predicted 690
8 SASI_Hs01_00192131 predicted 742
9 SASI_Hs01_00192132 predicted 710
10 SASI_Hs01_00192133 predicted 739
11 SASI_Hs01_00192126 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179885 predicted 398
2 SASI_Hs01_00179886 predicted 378
3 SASI_Hs02_00351379 predicted 431
4 SASI_Hs01_00179888 predicted 468
5 SASI_Hs01_00179889 predicted 606
6 SASI_Hs01_00179890 predicted 646
7 SASI_Hs01_00179891 predicted 516
8 SASI_Hs01_00179892 predicted 576
9 SASI_Hs01_00179893 predicted 546
10 SASI_Hs01_00179894 predicted 572
11 SASI_Hs01_00179887 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091511 predicted 203
2 SASI_Rn01_00091513 predicted 311
3 SASI_Rn01_00091514 predicted 428
4 SASI_Rn01_00091515 predicted 282
5 SASI_Rn01_00091516 predicted 370
6 SASI_Rn02_00267347 predicted 289
7 SASI_Rn01_00091517 predicted 438
8 SASI_Rn01_00091518 predicted 370
9 SASI_Rn01_00091519 predicted 299
10 SASI_Rn02_00267348 predicted 266
11 SASI_Rn01_00091512 predicted 336
12 SASI_Rn01_00091520 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309509 predicted 424
2 SASI_Mm02_00309510 predicted 408
3 SASI_Mm02_00309511 predicted 688
4 SASI_Mm02_00309512 predicted 407
5 SASI_Mm02_00309513 predicted 667
6 SASI_Mm02_00309514 predicted 486
7 SASI_Mm02_00309515 predicted 443
8 SASI_Mm02_00309516 predicted 835
9 SASI_Mm02_00309517 predicted 820
10 SASI_Mm02_00309518 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189395 predicted 363
2 SASI_Mm01_00189397 predicted 351
3 SASI_Mm01_00189399 predicted 636
4 SASI_Mm01_00189400 predicted 344
5 SASI_Mm02_00321496 predicted 610
6 SASI_Mm01_00189402 predicted 427
7 SASI_Mm02_00321497 predicted 377
8 SASI_Mm02_00321498 predicted 775
9 SASI_Mm01_00189394 predicted 770
10 SASI_Mm02_00321499 predicted 770
11 SASI_Mm01_00189396 predicted 318
12 SASI_Mm01_00189398 predicted 286
13 SASI_Mm01_00189401 predicted 273
14 SASI_Mm01_00189403 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018147
VALIDATED
FAIM MISSION shRNA Bacterial Glycerol Stock
Fas apoptotic inhibitory molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-441s1c1
Sequence:CCGGGCTATGGACGTATGGTGCAATCTCGAGATTGCACCATACGTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.1-486s1c1
Sequence:CCGGGAGTTTGTAGATGATGGGACTCTCGAGAGTCCCATCATCTACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-538s1c1
Sequence:CCGGGTTACATAAAGGCTGTCAGTACTCGAGTACTGACAGCCTTTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018147.1-567s1c1
Sequence:CCGGCGGAAAGAAGGGATTATTCATCTCGAGATGAATAATCCCTTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-180s1c1
Sequence:CCGGCGAGTAGTATATGTAGATGGACTCGAGTCCATCTACATATACTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018147.1-224s1c1
Sequence:CCGGGATGTTCAAATTAGTGGGCAACTCGAGTTGCCCACTAATTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-138s1c1
Sequence:CCGGGTCCACAAGATCGAATTTGAACTCGAGTTCAAATTCGATCTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.1-563s1c1
Sequence:CCGGGAAGCGGAAAGAAGGGATTATCTCGAGATAATCCCTTCTTTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.2-747s1c1
Sequence:CCGGAGTTACATGAAACTAACATTCCTCGAGGAATGTTAGTTTCATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.2-689s1c1
Sequence:CCGGATGTGTTCAGTATGTACTTATCTCGAGATAAGTACATACTGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018147
VALIDATED
FAIM MISSION shRNA shRNA Plasmid DNA
Fas apoptotic inhibitory molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-441s1c1
Sequence:CCGGGCTATGGACGTATGGTGCAATCTCGAGATTGCACCATACGTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.1-486s1c1
Sequence:CCGGGAGTTTGTAGATGATGGGACTCTCGAGAGTCCCATCATCTACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-538s1c1
Sequence:CCGGGTTACATAAAGGCTGTCAGTACTCGAGTACTGACAGCCTTTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018147.1-567s1c1
Sequence:CCGGCGGAAAGAAGGGATTATTCATCTCGAGATGAATAATCCCTTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-180s1c1
Sequence:CCGGCGAGTAGTATATGTAGATGGACTCGAGTCCATCTACATATACTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018147.1-224s1c1
Sequence:CCGGGATGTTCAAATTAGTGGGCAACTCGAGTTGCCCACTAATTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-138s1c1
Sequence:CCGGGTCCACAAGATCGAATTTGAACTCGAGTTCAAATTCGATCTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.1-563s1c1
Sequence:CCGGGAAGCGGAAAGAAGGGATTATCTCGAGATAATCCCTTCTTTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.2-747s1c1
Sequence:CCGGAGTTACATGAAACTAACATTCCTCGAGGAATGTTAGTTTCATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.2-689s1c1
Sequence:CCGGATGTGTTCAGTATGTACTTATCTCGAGATAAGTACATACTGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018147
VALIDATED
FAIM MISSION shRNA Lentiviral Transduction Particles
Fas apoptotic inhibitory molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-441s1c1
Sequence:CCGGGCTATGGACGTATGGTGCAATCTCGAGATTGCACCATACGTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.1-486s1c1
Sequence:CCGGGAGTTTGTAGATGATGGGACTCTCGAGAGTCCCATCATCTACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-538s1c1
Sequence:CCGGGTTACATAAAGGCTGTCAGTACTCGAGTACTGACAGCCTTTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018147.1-567s1c1
Sequence:CCGGCGGAAAGAAGGGATTATTCATCTCGAGATGAATAATCCCTTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-180s1c1
Sequence:CCGGCGAGTAGTATATGTAGATGGACTCGAGTCCATCTACATATACTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018147.1-224s1c1
Sequence:CCGGGATGTTCAAATTAGTGGGCAACTCGAGTTGCCCACTAATTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018147.1-138s1c1
Sequence:CCGGGTCCACAAGATCGAATTTGAACTCGAGTTCAAATTCGATCTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.1-563s1c1
Sequence:CCGGGAAGCGGAAAGAAGGGATTATCTCGAGATAATCCCTTCTTTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.2-747s1c1
Sequence:CCGGAGTTACATGAAACTAACATTCCTCGAGGAATGTTAGTTTCATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018147.2-689s1c1
Sequence:CCGGATGTGTTCAGTATGTACTTATCTCGAGATAAGTACATACTGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122851
FAIM MISSION shRNA Bacterial Glycerol Stock
Fas apoptotic inhibitory molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-400s21c1
Sequence:CCGGACCAAAGCCACCATCAATATACTCGAGTATATTGATGGTGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122851.1-806s21c1
Sequence:CCGGCCGATGGCTGTGGTAATTAAACTCGAGTTTAATTACCACAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-441s21c1
Sequence:CCGGATACGAGTACACGCTGGAAATCTCGAGATTTCCAGCGTGTACTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-236s21c1
Sequence:CCGGCTGTTTGGGACGTAGCATTAACTCGAGTTAATGCTACGTCCCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-188s21c1
Sequence:CCGGATGATGAAAGCCCTCTCTATACTCGAGTATAGAGAGGGCTTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122851
FAIM MISSION shRNA shRNA Plasmid DNA
Fas apoptotic inhibitory molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-400s21c1
Sequence:CCGGACCAAAGCCACCATCAATATACTCGAGTATATTGATGGTGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122851.1-806s21c1
Sequence:CCGGCCGATGGCTGTGGTAATTAAACTCGAGTTTAATTACCACAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-441s21c1
Sequence:CCGGATACGAGTACACGCTGGAAATCTCGAGATTTCCAGCGTGTACTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-236s21c1
Sequence:CCGGCTGTTTGGGACGTAGCATTAACTCGAGTTAATGCTACGTCCCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-188s21c1
Sequence:CCGGATGATGAAAGCCCTCTCTATACTCGAGTATAGAGAGGGCTTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122851
FAIM MISSION shRNA Lentiviral Transduction Particles
Fas apoptotic inhibitory molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-400s21c1
Sequence:CCGGACCAAAGCCACCATCAATATACTCGAGTATATTGATGGTGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122851.1-806s21c1
Sequence:CCGGCCGATGGCTGTGGTAATTAAACTCGAGTTTAATTACCACAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-441s21c1
Sequence:CCGGATACGAGTACACGCTGGAAATCTCGAGATTTCCAGCGTGTACTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-236s21c1
Sequence:CCGGCTGTTTGGGACGTAGCATTAACTCGAGTTAATGCTACGTCCCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122851.1-188s21c1
Sequence:CCGGATGATGAAAGCCCTCTCTATACTCGAGTATAGAGAGGGCTTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks