EMAIL THIS PAGE TO A FRIEND

FAM101A

family with sequence similarity 101, member A

43 Gene Product Result for
UniProtKB ID: Q6ZTI6, A5D8T5
Gene ID:
Mouse(73121) family with sequence similarity 101, member A
Rat(689711) family with sequence similarity 101, member A
sheep(101115905) family with sequence similarity 101, member A
naked mole-rat(101702287) family with sequence similarity 101, member A
domestic guinea pig(100720474) family with sequence similarity 101, member A
Zebrafish(368489) family with sequence similarity 101, member A
chicken(771797) family with sequence similarity 101, member A
cow(507695) family with sequence similarity 101, member A
domestic cat(101084234) family with sequence similarity 101, member A
dog(610487) family with sequence similarity 101, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181709 Rosetta Predictions human pricing
NM_001109547 Rosetta Predictions rat pricing
NM_028443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075404 predicted 415
2 SASI_Hs02_00370313 predicted 273
3 SASI_Hs01_00075405 predicted 848
4 SASI_Hs01_00075406 predicted 1074
5 SASI_Hs01_00075408 predicted 313
6 SASI_Hs01_00075409 predicted 1878
7 SASI_Hs02_00370314 predicted 2078
8 SASI_Hs01_00075410 predicted 1612
9 SASI_Hs01_00075411 predicted 1488
10 SASI_Hs01_00075413 predicted 1702
11 SASI_Hs01_00075407 predicted 277
12 SASI_Hs01_00075412 predicted 2100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249469 predicted 1141
2 SASI_Rn02_00249470 predicted 430
3 SASI_Rn02_00249471 predicted 1163
4 SASI_Rn02_00249472 predicted 829
5 SASI_Rn02_00249473 predicted 836
6 SASI_Rn02_00249474 predicted 1161
7 SASI_Rn02_00249475 predicted 1138
8 SASI_Rn02_00249476 predicted 832
9 SASI_Rn02_00249477 predicted 897
10 SASI_Rn02_00249478 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091324 predicted 334
2 SASI_Mm01_00091325 predicted 395
3 SASI_Mm01_00091326 predicted 362
4 SASI_Mm01_00091327 predicted 240
5 SASI_Mm01_00091328 predicted 712
6 SASI_Mm01_00091329 predicted 257
7 SASI_Mm01_00091330 predicted 306
8 SASI_Mm01_00091331 predicted 948
9 SASI_Mm01_00091332 predicted 1154
10 SASI_Mm02_00333882 predicted 904
11 SASI_Mm01_00091333 predicted 802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181709
FAM101A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 101, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-304s21c1
Sequence:CCGGACGCATGAGATCCGCTGCAACCTCGAGGTTGCAGCGGATCTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-336s21c1
Sequence:CCGGGTACGCCTCGGAGAAGCATTTCTCGAGAAATGCTTCTCCGAGGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181709.3-1563s21c1
Sequence:CCGGGAGCTCAGCTGTCGGTTTAAACTCGAGTTTAAACCGACAGCTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-358s21c1
Sequence:CCGGCAGGACAAGGTCTTCTATGCGCTCGAGCGCATAGAAGACCTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-516s21c1
Sequence:CCGGCAAGCATGCCAGGAGCACTTTCTCGAGAAAGTGCTCCTGGCATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181709.2-346s1c1
Sequence:CCGGGAGAAGCATTTCCAGGACAAGCTCGAGCTTGTCCTGGAAATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181709.2-348s1c1
Sequence:CCGGGAAGCATTTCCAGGACAAGGTCTCGAGACCTTGTCCTGGAAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181709
FAM101A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 101, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-304s21c1
Sequence:CCGGACGCATGAGATCCGCTGCAACCTCGAGGTTGCAGCGGATCTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-336s21c1
Sequence:CCGGGTACGCCTCGGAGAAGCATTTCTCGAGAAATGCTTCTCCGAGGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181709.3-1563s21c1
Sequence:CCGGGAGCTCAGCTGTCGGTTTAAACTCGAGTTTAAACCGACAGCTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-358s21c1
Sequence:CCGGCAGGACAAGGTCTTCTATGCGCTCGAGCGCATAGAAGACCTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-516s21c1
Sequence:CCGGCAAGCATGCCAGGAGCACTTTCTCGAGAAAGTGCTCCTGGCATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181709.2-346s1c1
Sequence:CCGGGAGAAGCATTTCCAGGACAAGCTCGAGCTTGTCCTGGAAATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181709.2-348s1c1
Sequence:CCGGGAAGCATTTCCAGGACAAGGTCTCGAGACCTTGTCCTGGAAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181709
FAM101A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 101, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-304s21c1
Sequence:CCGGACGCATGAGATCCGCTGCAACCTCGAGGTTGCAGCGGATCTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-336s21c1
Sequence:CCGGGTACGCCTCGGAGAAGCATTTCTCGAGAAATGCTTCTCCGAGGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181709.3-1563s21c1
Sequence:CCGGGAGCTCAGCTGTCGGTTTAAACTCGAGTTTAAACCGACAGCTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-358s21c1
Sequence:CCGGCAGGACAAGGTCTTCTATGCGCTCGAGCGCATAGAAGACCTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181709.3-516s21c1
Sequence:CCGGCAAGCATGCCAGGAGCACTTTCTCGAGAAAGTGCTCCTGGCATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181709.2-346s1c1
Sequence:CCGGGAGAAGCATTTCCAGGACAAGCTCGAGCTTGTCCTGGAAATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181709.2-348s1c1
Sequence:CCGGGAAGCATTTCCAGGACAAGGTCTCGAGACCTTGTCCTGGAAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028443
VALIDATED
FAM101A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 101, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-402s1c1
Sequence:CCGGAGAGAGATACTTCCGAGACAACTCGAGTTGTCTCGGAAGTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028443.1-393s1c1
Sequence:CCGGCTACGCCTCAGAGAGATACTTCTCGAGAAGTATCTCTCTGAGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-262s1c1
Sequence:CCGGGCGGCTCCTTCCCTCTTCCAACTCGAGTTGGAAGAGGGAAGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-1162s1c1
Sequence:CCGGCCAGACTAGCTTAGAACTCTTCTCGAGAAGAGTTCTAAGCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-360s1c1
Sequence:CCGGCGCACATGAAATCCGCTGCAACTCGAGTTGCAGCGGATTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028443
VALIDATED
FAM101A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 101, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-402s1c1
Sequence:CCGGAGAGAGATACTTCCGAGACAACTCGAGTTGTCTCGGAAGTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028443.1-393s1c1
Sequence:CCGGCTACGCCTCAGAGAGATACTTCTCGAGAAGTATCTCTCTGAGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-262s1c1
Sequence:CCGGGCGGCTCCTTCCCTCTTCCAACTCGAGTTGGAAGAGGGAAGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-1162s1c1
Sequence:CCGGCCAGACTAGCTTAGAACTCTTCTCGAGAAGAGTTCTAAGCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-360s1c1
Sequence:CCGGCGCACATGAAATCCGCTGCAACTCGAGTTGCAGCGGATTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028443
VALIDATED
FAM101A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 101, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-402s1c1
Sequence:CCGGAGAGAGATACTTCCGAGACAACTCGAGTTGTCTCGGAAGTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028443.1-393s1c1
Sequence:CCGGCTACGCCTCAGAGAGATACTTCTCGAGAAGTATCTCTCTGAGGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-262s1c1
Sequence:CCGGGCGGCTCCTTCCCTCTTCCAACTCGAGTTGGAAGAGGGAAGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-1162s1c1
Sequence:CCGGCCAGACTAGCTTAGAACTCTTCTCGAGAAGAGTTCTAAGCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028443.1-360s1c1
Sequence:CCGGCGCACATGAAATCCGCTGCAACTCGAGTTGCAGCGGATTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks