EMAIL THIS PAGE TO A FRIEND

FAM101B

family with sequence similarity 101, member B

95 Gene Product Result for
UniProtKB ID: Q8N5W9
Gene ID:
Mouse(76566) family with sequence similarity 101, member B
Rat(287534) family with sequence similarity 101, member B
Zebrafish(100286814) family with sequence similarity 101, member B
chicken(417623) family with sequence similarity 101, member B
dog(611214) family with sequence similarity 101, member B
cow(618459) family with sequence similarity 101, member B
domestic cat(101087112) family with sequence similarity 101, member B
naked mole-rat(101715139) family with sequence similarity 101, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182705 Rosetta Predictions human pricing
NM_001007611 Rosetta Predictions rat pricing
XM_001080740 Rosetta Predictions rat pricing
XM_893392 Rosetta Predictions mouse pricing
XM_983541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066523 predicted 613
2 SASI_Hs02_00370871 predicted 373
3 SASI_Hs02_00370872 predicted 965
4 SASI_Hs01_00066517 predicted 618
5 SASI_Hs02_00370873 predicted 1200
6 SASI_Hs02_00370874 predicted 888
7 SASI_Hs02_00370875 predicted 804
8 SASI_Hs02_00370876 predicted 778
9 SASI_Hs02_00370877 predicted 1143
10 SASI_Hs02_00370878 predicted 1194
11 SASI_Hs01_00066518 predicted 539
12 SASI_Hs01_00066519 predicted 599
13 SASI_Hs01_00066520 predicted 542
14 SASI_Hs01_00066521 predicted 552
15 SASI_Hs01_00066522 predicted 532
16 SASI_Hs01_00066524 predicted 544
17 SASI_Hs01_00066525 predicted 519
18 SASI_Hs01_00066526 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198698 predicted 461
2 SASI_Rn02_00198699 predicted 469
3 SASI_Rn01_00104287 predicted 450
4 SASI_Rn01_00104289 predicted 671
5 SASI_Rn02_00198700 predicted 684
6 SASI_Rn02_00198701 predicted 557
7 SASI_Rn01_00104290 predicted 649
8 SASI_Rn01_00104291 predicted 356
9 SASI_Rn01_00104294 predicted 346
10 SASI_Rn01_00104295 predicted 686
11 SASI_Rn01_00104288 predicted 646
12 SASI_Rn01_00104292 predicted 339
13 SASI_Rn01_00104293 predicted 314
14 SASI_Rn01_00104296 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369150 predicted 843
2 SASI_Rn02_00369151 predicted 214
3 SASI_Rn02_00369152 predicted 840
4 SASI_Rn02_00369153 predicted 1049
5 SASI_Rn02_00369154 predicted 1075
6 SASI_Rn02_00369155 predicted 690
7 SASI_Rn02_00369156 predicted 1034
8 SASI_Rn02_00369157 predicted 737
9 SASI_Rn02_00369158 predicted 726
10 SASI_Rn02_00369159 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254641 predicted 440
2 SASI_Mm01_00254642 predicted 491
3 SASI_Mm01_00254643 predicted 1172
4 SASI_Mm01_00254644 predicted 1095
5 SASI_Mm01_00254645 predicted 1208
6 SASI_Mm01_00254646 predicted 902
7 SASI_Mm01_00254647 predicted 754
8 SASI_Mm01_00254648 predicted 1242
9 SASI_Mm01_00254649 predicted 405
10 SASI_Mm01_00254650 predicted 169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448203 predicted 488
2 SASI_Mm02_00448204 predicted 408
3 SASI_Mm02_00448205 predicted 709
4 SASI_Mm02_00448206 predicted 485
5 SASI_Mm02_00448207 predicted 470
6 SASI_Mm02_00448208 predicted 672
7 SASI_Mm02_00448209 predicted 696
8 SASI_Mm02_00448210 predicted 690
9 SASI_Mm02_00448211 predicted 475
10 SASI_Mm02_00448212 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182705
VALIDATED
FAM101B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 101, member B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000263729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-402s21c1
Sequence:CCGGACTCCGAGAGGCACTTCATCGCTCGAGCGATGAAGTGCCTCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-357s21c1
Sequence:CCGGCCTTACCACCAAAGGAAGTAACTCGAGTTACTTCCTTTGGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-99s21c1
Sequence:CCGGAGCTCGTGGACGCGAAGAAGACTCGAGTCTTCTTCGCGTCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-379s21c1
Sequence:CCGGGTACACCTCCTTGGTCAAGTACTCGAGTACTTGACCAAGGAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182705
VALIDATED
FAM101B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 101, member B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000263729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-402s21c1
Sequence:CCGGACTCCGAGAGGCACTTCATCGCTCGAGCGATGAAGTGCCTCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-357s21c1
Sequence:CCGGCCTTACCACCAAAGGAAGTAACTCGAGTTACTTCCTTTGGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-99s21c1
Sequence:CCGGAGCTCGTGGACGCGAAGAAGACTCGAGTCTTCTTCGCGTCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-379s21c1
Sequence:CCGGGTACACCTCCTTGGTCAAGTACTCGAGTACTTGACCAAGGAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182705
VALIDATED
FAM101B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 101, member B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000263729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-402s21c1
Sequence:CCGGACTCCGAGAGGCACTTCATCGCTCGAGCGATGAAGTGCCTCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-357s21c1
Sequence:CCGGCCTTACCACCAAAGGAAGTAACTCGAGTTACTTCCTTTGGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-99s21c1
Sequence:CCGGAGCTCGTGGACGCGAAGAAGACTCGAGTCTTCTTCGCGTCCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_182705.2-379s21c1
Sequence:CCGGGTACACCTCCTTGGTCAAGTACTCGAGTACTTGACCAAGGAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks