EMAIL THIS PAGE TO A FRIEND

FAM102A

family with sequence similarity 102, member A

115 Gene Product Result for
Synonyms: C9orf132 EEIG1 SYM-3A bA203J24.7
UniProtKB ID: Q5T9C2, A2A329, Q8TEL4
Gene ID:
Mouse(98952) family with sequence similarity 102, member A
Rat(687750) family with sequence similarity 102, member A
sheep(101122506) family with sequence similarity 102, member A
naked mole-rat(101715915) family with sequence similarity 102, member A
domestic guinea pig(100723734) family with sequence similarity 102, member A
chicken(417228) family with sequence similarity 102, member A
cow(615907) family with sequence similarity 102, member A
domestic cat(101094963) family with sequence similarity 102, member A
dog(491323) family with sequence similarity 102, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063511 MISSION® esiRNA esiRNA human FAM102A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035254 Rosetta Predictions human pricing
NM_203305 Rosetta Predictions human pricing
XM_001080009 Rosetta Predictions rat pricing
NM_153560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142276 predicted 693
2 SASI_Hs02_00308176 predicted 1206
3 SASI_Hs02_00308177 predicted 965
4 SASI_Hs02_00308178 predicted 1121
5 SASI_Hs01_00142277 predicted 1568
6 SASI_Hs01_00142280 predicted 1171
7 SASI_Hs01_00142281 predicted 1200
8 SASI_Hs01_00142282 predicted 1443
9 SASI_Hs01_00142283 predicted 985
10 SASI_Hs01_00142284 predicted 1660
11 SASI_Hs01_00142275 predicted 1731
12 SASI_Hs01_00142278 predicted 1261
13 SASI_Hs01_00142279 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243998 predicted 500
2 SASI_Hs02_00373241 predicted 1005
3 SASI_Hs02_00373242 predicted 762
4 SASI_Hs02_00373243 predicted 922
5 SASI_Hs01_00243999 predicted 1364
6 SASI_Hs01_00244002 predicted 972
7 SASI_Hs01_00244003 predicted 1001
8 SASI_Hs01_00244004 predicted 1241
9 SASI_Hs01_00244005 predicted 782
10 SASI_Hs01_00244006 predicted 1464
11 SASI_Hs01_00243997 predicted 1531
12 SASI_Hs01_00244000 predicted 1059
13 SASI_Hs01_00244001 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366228 predicted 1754
2 SASI_Rn02_00366229 predicted 1063
3 SASI_Rn02_00366230 predicted 1027
4 SASI_Rn02_00366231 predicted 2394
5 SASI_Rn02_00366232 predicted 2030
6 SASI_Rn02_00366233 predicted 1321
7 SASI_Rn02_00366234 predicted 1768
8 SASI_Rn02_00366235 predicted 1184
9 SASI_Rn02_00366236 predicted 1909
10 SASI_Rn02_00366237 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343343 predicted 2178
2 SASI_Mm01_00116841 predicted 1027
3 SASI_Mm01_00116842 predicted 1709
4 SASI_Mm01_00116843 predicted 1866
5 SASI_Mm01_00116844 predicted 1437
6 SASI_Mm01_00116845 predicted 1279
7 SASI_Mm01_00116847 predicted 1696
8 SASI_Mm01_00116848 predicted 1785
9 SASI_Mm01_00116849 predicted 2338
10 SASI_Mm02_00343344 predicted 1878
11 SASI_Mm01_00116840 predicted 1006
12 SASI_Mm01_00116846 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203305
FAM102A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 102, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-874s21c1
Sequence:CCGGGATCGTGCAGAGCCAGGATTTCTCGAGAAATCCTGGCTCTGCACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-773s21c1
Sequence:CCGGCATCTGTCCGATCGCTCTTTCCTCGAGGAAAGAGCGATCGGACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-1002s21c1
Sequence:CCGGTCTACGAGCCAGTTGTGATTGCTCGAGCAATCACAACTGGCTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203305.2-3226s21c1
Sequence:CCGGGAGAGTATATCAGAGATATTTCTCGAGAAATATCTCTGATATACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-585s21c1
Sequence:CCGGAGTCCAAGATCTCCGGCTACACTCGAGTGTAGCCGGAGATCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203305.1-2635s1c1
Sequence:CCGGCAGCATTTGTTGTTGTTGTTTCTCGAGAAACAACAACAACAAATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203305.1-2767s1c1
Sequence:CCGGCCACCGATACTGGCACTTTAACTCGAGTTAAAGTGCCAGTATCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203305
FAM102A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 102, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-874s21c1
Sequence:CCGGGATCGTGCAGAGCCAGGATTTCTCGAGAAATCCTGGCTCTGCACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-773s21c1
Sequence:CCGGCATCTGTCCGATCGCTCTTTCCTCGAGGAAAGAGCGATCGGACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-1002s21c1
Sequence:CCGGTCTACGAGCCAGTTGTGATTGCTCGAGCAATCACAACTGGCTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203305.2-3226s21c1
Sequence:CCGGGAGAGTATATCAGAGATATTTCTCGAGAAATATCTCTGATATACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-585s21c1
Sequence:CCGGAGTCCAAGATCTCCGGCTACACTCGAGTGTAGCCGGAGATCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203305.1-2635s1c1
Sequence:CCGGCAGCATTTGTTGTTGTTGTTTCTCGAGAAACAACAACAACAAATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203305.1-2767s1c1
Sequence:CCGGCCACCGATACTGGCACTTTAACTCGAGTTAAAGTGCCAGTATCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203305
FAM102A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 102, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-874s21c1
Sequence:CCGGGATCGTGCAGAGCCAGGATTTCTCGAGAAATCCTGGCTCTGCACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-773s21c1
Sequence:CCGGCATCTGTCCGATCGCTCTTTCCTCGAGGAAAGAGCGATCGGACAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-1002s21c1
Sequence:CCGGTCTACGAGCCAGTTGTGATTGCTCGAGCAATCACAACTGGCTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203305.2-3226s21c1
Sequence:CCGGGAGAGTATATCAGAGATATTTCTCGAGAAATATCTCTGATATACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203305.2-585s21c1
Sequence:CCGGAGTCCAAGATCTCCGGCTACACTCGAGTGTAGCCGGAGATCTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183140    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203305.1-2635s1c1
Sequence:CCGGCAGCATTTGTTGTTGTTGTTTCTCGAGAAACAACAACAACAAATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203305.1-2767s1c1
Sequence:CCGGCCACCGATACTGGCACTTTAACTCGAGTTAAAGTGCCAGTATCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153560
VALIDATED
FAM102A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 102, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-1508s1c1
Sequence:CCGGGCAGAAATACATCCACCAGCACTCGAGTGCTGGTGGATGTATTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1495s1c1
Sequence:CCGGGACTTGACACACCGCAGAAATCTCGAGATTTCTGCGGTGTGTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153560.2-1042s1c1
Sequence:CCGGGACTTGAACCTAGCCGAGTTTCTCGAGAAACTCGGCTAGGTTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153560.2-3836s1c1
Sequence:CCGGCCTGGACTTCAAATTCTATATCTCGAGATATAGAATTTGAAGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1711s1c1
Sequence:CCGGGTAGATGACACTCGAATTGATCTCGAGATCAATTCGAGTGTCATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1650s1c1
Sequence:CCGGGCATCTATCAGATCGCTCTTTCTCGAGAAAGAGCGATCTGATAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-1143s1c1
Sequence:CCGGCAAGGTCACCATTGGCATGTTCTCGAGAACATGCCAATGGTGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-915s1c1
Sequence:CCGGGAGGTTCACCTTTGTGTGTAACTCGAGTTACACACAAAGGTGAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153560
VALIDATED
FAM102A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 102, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-1508s1c1
Sequence:CCGGGCAGAAATACATCCACCAGCACTCGAGTGCTGGTGGATGTATTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1495s1c1
Sequence:CCGGGACTTGACACACCGCAGAAATCTCGAGATTTCTGCGGTGTGTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153560.2-1042s1c1
Sequence:CCGGGACTTGAACCTAGCCGAGTTTCTCGAGAAACTCGGCTAGGTTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153560.2-3836s1c1
Sequence:CCGGCCTGGACTTCAAATTCTATATCTCGAGATATAGAATTTGAAGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1711s1c1
Sequence:CCGGGTAGATGACACTCGAATTGATCTCGAGATCAATTCGAGTGTCATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1650s1c1
Sequence:CCGGGCATCTATCAGATCGCTCTTTCTCGAGAAAGAGCGATCTGATAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-1143s1c1
Sequence:CCGGCAAGGTCACCATTGGCATGTTCTCGAGAACATGCCAATGGTGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-915s1c1
Sequence:CCGGGAGGTTCACCTTTGTGTGTAACTCGAGTTACACACAAAGGTGAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153560
VALIDATED
FAM102A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 102, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-1508s1c1
Sequence:CCGGGCAGAAATACATCCACCAGCACTCGAGTGCTGGTGGATGTATTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1495s1c1
Sequence:CCGGGACTTGACACACCGCAGAAATCTCGAGATTTCTGCGGTGTGTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153560.2-1042s1c1
Sequence:CCGGGACTTGAACCTAGCCGAGTTTCTCGAGAAACTCGGCTAGGTTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153560.2-3836s1c1
Sequence:CCGGCCTGGACTTCAAATTCTATATCTCGAGATATAGAATTTGAAGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1711s1c1
Sequence:CCGGGTAGATGACACTCGAATTGATCTCGAGATCAATTCGAGTGTCATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153560.2-1650s1c1
Sequence:CCGGGCATCTATCAGATCGCTCTTTCTCGAGAAAGAGCGATCTGATAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-1143s1c1
Sequence:CCGGCAAGGTCACCATTGGCATGTTCTCGAGAACATGCCAATGGTGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153560.2-915s1c1
Sequence:CCGGGAGGTTCACCTTTGTGTGTAACTCGAGTTACACACAAAGGTGAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)