EMAIL THIS PAGE TO A FRIEND

FAM102B

family with sequence similarity 102, member B

118 Gene Product Result for
Synonyms: SYM-3B
UniProtKB ID: Q5T8I3, A1L1A1, B0QZ46, B0QZ47, Q68DH7
Gene ID:
Mouse(329739) family with sequence similarity 102, member B
Rat(365903) family with sequence similarity 102, member B
chicken(768922) family with sequence similarity 102, member B
cow(514601) family with sequence similarity 102, member B
domestic cat(101095839) family with sequence similarity 102, member B
dog(490130) family with sequence similarity 102, member B
domestic guinea pig(100725800) family with sequence similarity 102, member B
naked mole-rat(101717773) family with sequence similarity 102, member B
sheep(101121642) family with sequence similarity 102, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010883 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010883 Rosetta Predictions human pricing
XM_001072157 Rosetta Predictions rat pricing
XM_345273 Rosetta Predictions rat pricing
XM_283903 Rosetta Predictions mouse pricing
XM_974847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305838 predicted 1209
2 SASI_Hs01_00078118 predicted 865
3 SASI_Hs01_00078119 predicted 417
4 SASI_Hs01_00078120 predicted 613
5 SASI_Hs01_00078122 predicted 1024
6 SASI_Hs02_00305839 predicted 1147
7 SASI_Hs01_00078123 predicted 869
8 SASI_Hs01_00078125 predicted 1253
9 SASI_Hs01_00078126 predicted 541
10 SASI_Hs01_00078127 predicted 1200
11 SASI_Hs01_00078121 predicted 685
12 SASI_Hs01_00078124 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338038 predicted 461
2 SASI_Rn02_00338039 predicted 644
3 SASI_Rn02_00338040 predicted 1028
4 SASI_Rn02_00338041 predicted 582
5 SASI_Rn02_00338042 predicted 1070
6 SASI_Rn02_00338043 predicted 904
7 SASI_Rn02_00338044 predicted 1007
8 SASI_Rn02_00338045 predicted 1053
9 SASI_Rn02_00338046 predicted 1055
10 SASI_Rn02_00338047 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398144 predicted 560
2 SASI_Rn02_00398145 predicted 630
3 SASI_Rn02_00398146 predicted 742
4 SASI_Rn02_00398147 predicted 680
5 SASI_Rn02_00398148 predicted 664
6 SASI_Rn02_00398149 predicted 686
7 SASI_Rn02_00398150 predicted 675
8 SASI_Rn02_00398151 predicted 674
9 SASI_Rn02_00398152 predicted 739
10 SASI_Rn02_00398153 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258799 predicted 829
2 SASI_Mm01_00258800 predicted 461
3 SASI_Mm01_00258801 predicted 530
4 SASI_Mm01_00258803 predicted 1453
5 SASI_Mm01_00258804 predicted 682
6 SASI_Mm02_00425628 predicted 1257
7 SASI_Mm01_00258805 predicted 1446
8 SASI_Mm02_00425629 predicted 982
9 SASI_Mm01_00258806 predicted 634
10 SASI_Mm01_00258807 predicted 711
11 SASI_Mm01_00258802 predicted 1497
12 SASI_Mm01_00258808 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445430 predicted 539
2 SASI_Mm02_00445431 predicted 239
3 SASI_Mm02_00445432 predicted 857
4 SASI_Mm02_00445433 predicted 1157
5 SASI_Mm02_00445434 predicted 381
6 SASI_Mm02_00445435 predicted 963
7 SASI_Mm02_00445436 predicted 1152
8 SASI_Mm02_00445437 predicted 681
9 SASI_Mm02_00445438 predicted 337
10 SASI_Mm02_00445439 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010883
VALIDATED
FAM102B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 102, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-799s1c1
Sequence:CCGGCCAGTGAAACAAGATTCTGTACTCGAGTACAGAATCTTGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010883.1-178s1c1
Sequence:CCGGGATCCTTGTATCTACAGAGTACTCGAGTACTCTGTAGATACAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-971s1c1
Sequence:CCGGGCAGTCATCATCTTCCAAATACTCGAGTATTTGGAAGATGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010883.1-478s1c1
Sequence:CCGGGAGACTCTCAAAGTGCATCTTCTCGAGAAGATGCACTTTGAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010883.1-266s1c1
Sequence:CCGGCAGAGTTTGCTGGATCAGGAACTCGAGTTCCTGATCCAGCAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-104s1c1
Sequence:CCGGCAAACTGTGTTCGCTGGAGAACTCGAGTTCTCCAGCGAACACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-575s1c1
Sequence:CCGGGCTATGCAAGTCAGCAGTCAACTCGAGTTGACTGCTGACTTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-1790s1c1
Sequence:CCGGGCACCCTAACAGAAGAGCTATCTCGAGATAGCTCTTCTGTTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-229s1c1
Sequence:CCGGGCTTATGCAAAGCTGGGCTTTCTCGAGAAAGCCCAGCTTTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010883
VALIDATED
FAM102B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 102, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-799s1c1
Sequence:CCGGCCAGTGAAACAAGATTCTGTACTCGAGTACAGAATCTTGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010883.1-178s1c1
Sequence:CCGGGATCCTTGTATCTACAGAGTACTCGAGTACTCTGTAGATACAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-971s1c1
Sequence:CCGGGCAGTCATCATCTTCCAAATACTCGAGTATTTGGAAGATGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010883.1-478s1c1
Sequence:CCGGGAGACTCTCAAAGTGCATCTTCTCGAGAAGATGCACTTTGAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010883.1-266s1c1
Sequence:CCGGCAGAGTTTGCTGGATCAGGAACTCGAGTTCCTGATCCAGCAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-104s1c1
Sequence:CCGGCAAACTGTGTTCGCTGGAGAACTCGAGTTCTCCAGCGAACACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-575s1c1
Sequence:CCGGGCTATGCAAGTCAGCAGTCAACTCGAGTTGACTGCTGACTTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-1790s1c1
Sequence:CCGGGCACCCTAACAGAAGAGCTATCTCGAGATAGCTCTTCTGTTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-229s1c1
Sequence:CCGGGCTTATGCAAAGCTGGGCTTTCTCGAGAAAGCCCAGCTTTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010883
VALIDATED
FAM102B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 102, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-799s1c1
Sequence:CCGGCCAGTGAAACAAGATTCTGTACTCGAGTACAGAATCTTGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010883.1-178s1c1
Sequence:CCGGGATCCTTGTATCTACAGAGTACTCGAGTACTCTGTAGATACAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-971s1c1
Sequence:CCGGGCAGTCATCATCTTCCAAATACTCGAGTATTTGGAAGATGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010883.1-478s1c1
Sequence:CCGGGAGACTCTCAAAGTGCATCTTCTCGAGAAGATGCACTTTGAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010883.1-266s1c1
Sequence:CCGGCAGAGTTTGCTGGATCAGGAACTCGAGTTCCTGATCCAGCAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001010883.1-104s1c1
Sequence:CCGGCAAACTGTGTTCGCTGGAGAACTCGAGTTCTCCAGCGAACACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-575s1c1
Sequence:CCGGGCTATGCAAGTCAGCAGTCAACTCGAGTTGACTGCTGACTTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-1790s1c1
Sequence:CCGGGCACCCTAACAGAAGAGCTATCTCGAGATAGCTCTTCTGTTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001010883.1-229s1c1
Sequence:CCGGGCTTATGCAAAGCTGGGCTTTCTCGAGAAAGCCCAGCTTTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163567
VALIDATED
FAM102B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 102, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-532s21c1
Sequence:CCGGGTCTGTACGGAAGGAATTAAACTCGAGTTTAATTCCTTCCGTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-574s21c1
Sequence:CCGGGCTGGGCTTTGCAGATCTAAACTCGAGTTTAGATCTGCAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-455s21c1
Sequence:CCGGAGAAAGAAGTTCTCGTTTATGCTCGAGCATAAACGAGAACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-637s21c1
Sequence:CCGGTTTACTGGAAGGCTATGATACCTCGAGGTATCATAGCCTTCCAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-1716s21c1
Sequence:CCGGTTAGTACTCCAGCGTACATATCTCGAGATATGTACGCTGGAGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163567
VALIDATED
FAM102B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 102, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-532s21c1
Sequence:CCGGGTCTGTACGGAAGGAATTAAACTCGAGTTTAATTCCTTCCGTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-574s21c1
Sequence:CCGGGCTGGGCTTTGCAGATCTAAACTCGAGTTTAGATCTGCAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-455s21c1
Sequence:CCGGAGAAAGAAGTTCTCGTTTATGCTCGAGCATAAACGAGAACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-637s21c1
Sequence:CCGGTTTACTGGAAGGCTATGATACCTCGAGGTATCATAGCCTTCCAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-1716s21c1
Sequence:CCGGTTAGTACTCCAGCGTACATATCTCGAGATATGTACGCTGGAGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163567
VALIDATED
FAM102B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 102, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-532s21c1
Sequence:CCGGGTCTGTACGGAAGGAATTAAACTCGAGTTTAATTCCTTCCGTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-574s21c1
Sequence:CCGGGCTGGGCTTTGCAGATCTAAACTCGAGTTTAGATCTGCAAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-455s21c1
Sequence:CCGGAGAAAGAAGTTCTCGTTTATGCTCGAGCATAAACGAGAACTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-637s21c1
Sequence:CCGGTTTACTGGAAGGCTATGATACCTCGAGGTATCATAGCCTTCCAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001163567.1-1716s21c1
Sequence:CCGGTTAGTACTCCAGCGTACATATCTCGAGATATGTACGCTGGAGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks