EMAIL THIS PAGE TO A FRIEND

FAM103A1

family with sequence similarity 103, member A1

80 Gene Product Result for
Synonyms: C15orf18 HsT19360 RAM
UniProtKB ID: Q9BTL3, Q2M1J8
Gene ID:
Mouse(67148) family with sequence similarity 103, member A1
Rat(293058) family with sequence similarity 103, member A1
chicken(415459) family with sequence similarity 103, member A1
dog(479056) family with sequence similarity 103, member A1
cow(614296) family with sequence similarity 103, member A1
domestic cat(101089193) family with sequence similarity 103, member A1
sheep(101110793) family with sequence similarity 103, member A1
naked mole-rat(101705672) family with sequence similarity 103, member A1
domestic guinea pig(100730386) family with sequence similarity 103, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031452 Rosetta Predictions human pricing
NM_001127451 Rosetta Predictions rat pricing
NM_025997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358864 predicted 346
2 SASI_Hs01_00208024 predicted 350
3 SASI_Hs01_00208025 predicted 291
4 SASI_Hs01_00208026 predicted 199
5 SASI_Hs01_00208028 predicted 282
6 SASI_Hs01_00208030 predicted 219
7 SASI_Hs02_00358865 predicted 256
8 SASI_Hs01_00208031 predicted 445
9 SASI_Hs02_00358866 predicted 252
10 SASI_Hs01_00208032 predicted 402
11 SASI_Hs01_00208023 predicted 263
12 SASI_Hs01_00208027 predicted 371
13 SASI_Hs01_00208029 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253773 predicted 220
2 SASI_Rn02_00253774 predicted 276
3 SASI_Rn02_00253775 predicted 321
4 SASI_Rn02_00253776 predicted 519
5 SASI_Rn02_00253777 predicted 401
6 SASI_Rn02_00253778 predicted 466
7 SASI_Rn02_00253779 predicted 424
8 SASI_Rn02_00253780 predicted 570
9 SASI_Rn02_00253781 predicted 331
10 SASI_Rn02_00253782 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113988 predicted 343
2 SASI_Mm01_00113989 predicted 910
3 SASI_Mm01_00113990 predicted 654
4 SASI_Mm01_00113991 predicted 753
5 SASI_Mm01_00113992 predicted 662
6 SASI_Mm01_00113993 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031452
FAM103A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 103, member A1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031452.2-222s21c1
Sequence:CCGGGAGATGTTTGCTAGTAGATTCCTCGAGGAATCTACTAGCAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031452.2-775s21c1
Sequence:CCGGCATGACTTAATAGTGCTTTAACTCGAGTTAAAGCACTATTAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031452.2-683s21c1
Sequence:CCGGATAGATCTTACTTGCGAAATGCTCGAGCATTTCGCAAGTAAGATCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-743s1c1
Sequence:CCGGGCTTGACTTCTACCTCAGAATCTCGAGATTCTGAGGTAGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-717s1c1
Sequence:CCGGGAATACCTGAAACTGTGGATTCTCGAGAATCCACAGTTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-877s1c1
Sequence:CCGGGTAAGGTAAGAGAGTATCCATCTCGAGATGGATACTCTCTTACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031452.2-303s1c1
Sequence:CCGGGTTGAGGAATGGAATAGCAGACTCGAGTCTGCTATTCCATTCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031452.2-297s1c1
Sequence:CCGGCCAATTGTTGAGGAATGGAATCTCGAGATTCCATTCCTCAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031452
FAM103A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 103, member A1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031452.2-222s21c1
Sequence:CCGGGAGATGTTTGCTAGTAGATTCCTCGAGGAATCTACTAGCAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031452.2-775s21c1
Sequence:CCGGCATGACTTAATAGTGCTTTAACTCGAGTTAAAGCACTATTAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031452.2-683s21c1
Sequence:CCGGATAGATCTTACTTGCGAAATGCTCGAGCATTTCGCAAGTAAGATCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-743s1c1
Sequence:CCGGGCTTGACTTCTACCTCAGAATCTCGAGATTCTGAGGTAGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-717s1c1
Sequence:CCGGGAATACCTGAAACTGTGGATTCTCGAGAATCCACAGTTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-877s1c1
Sequence:CCGGGTAAGGTAAGAGAGTATCCATCTCGAGATGGATACTCTCTTACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031452.2-303s1c1
Sequence:CCGGGTTGAGGAATGGAATAGCAGACTCGAGTCTGCTATTCCATTCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031452.2-297s1c1
Sequence:CCGGCCAATTGTTGAGGAATGGAATCTCGAGATTCCATTCCTCAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031452
FAM103A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 103, member A1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031452.2-222s21c1
Sequence:CCGGGAGATGTTTGCTAGTAGATTCCTCGAGGAATCTACTAGCAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031452.2-775s21c1
Sequence:CCGGCATGACTTAATAGTGCTTTAACTCGAGTTAAAGCACTATTAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031452.2-683s21c1
Sequence:CCGGATAGATCTTACTTGCGAAATGCTCGAGCATTTCGCAAGTAAGATCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-743s1c1
Sequence:CCGGGCTTGACTTCTACCTCAGAATCTCGAGATTCTGAGGTAGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-717s1c1
Sequence:CCGGGAATACCTGAAACTGTGGATTCTCGAGAATCCACAGTTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031452.2-877s1c1
Sequence:CCGGGTAAGGTAAGAGAGTATCCATCTCGAGATGGATACTCTCTTACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031452.2-303s1c1
Sequence:CCGGGTTGAGGAATGGAATAGCAGACTCGAGTCTGCTATTCCATTCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031452.2-297s1c1
Sequence:CCGGCCAATTGTTGAGGAATGGAATCTCGAGATTCCATTCCTCAACAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025997
FAM103A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 103, member A1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025997.2-1008s1c1
Sequence:CCGGGAACTGCTTTGGTCCTATATGCTCGAGCATATAGGACCAAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025997.2-972s21c1
Sequence:CCGGCATGGTGTCTTGTGGTTTATACTCGAGTATAAACCACAAGACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-351s21c1
Sequence:CCGGCCAAGTGACAATCGGTCAAATCTCGAGATTTGACCGATTGTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-415s21c1
Sequence:CCGGAGAGACCAGAGCCCTACTATCCTCGAGGATAGTAGGGCTCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-329s21c1
Sequence:CCGGTAGGGATAACAGACGAGGATGCTCGAGCATCCTCGTCTGTTATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-304s21c1
Sequence:CCGGTGCAAGACAACAGACAATTTACTCGAGTAAATTGTCTGTTGTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025997.1-420s1c1
Sequence:CCGGCCAGAGCCCTACTATCAACAACTCGAGTTGTTGATAGTAGGGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025997.1-350s1c1
Sequence:CCGGGCCAAGTGACAATCGGTCAAACTCGAGTTTGACCGATTGTCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-204s1c1
Sequence:CCGGGAATACCAGGAATACTTGAAACTCGAGTTTCAAGTATTCCTGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-195s1c1
Sequence:CCGGGATGACAAAGAATACCAGGAACTCGAGTTCCTGGTATTCTTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-435s1c1
Sequence:CCGGCAACAACAGTACACACAGTATCTCGAGATACTGTGTGTACTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-425s1c1
Sequence:CCGGGCCCTACTATCAACAACAGTACTCGAGTACTGTTGTTGATAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025997
FAM103A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 103, member A1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025997.2-1008s1c1
Sequence:CCGGGAACTGCTTTGGTCCTATATGCTCGAGCATATAGGACCAAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025997.2-972s21c1
Sequence:CCGGCATGGTGTCTTGTGGTTTATACTCGAGTATAAACCACAAGACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-351s21c1
Sequence:CCGGCCAAGTGACAATCGGTCAAATCTCGAGATTTGACCGATTGTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-415s21c1
Sequence:CCGGAGAGACCAGAGCCCTACTATCCTCGAGGATAGTAGGGCTCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-329s21c1
Sequence:CCGGTAGGGATAACAGACGAGGATGCTCGAGCATCCTCGTCTGTTATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-304s21c1
Sequence:CCGGTGCAAGACAACAGACAATTTACTCGAGTAAATTGTCTGTTGTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025997.1-420s1c1
Sequence:CCGGCCAGAGCCCTACTATCAACAACTCGAGTTGTTGATAGTAGGGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025997.1-350s1c1
Sequence:CCGGGCCAAGTGACAATCGGTCAAACTCGAGTTTGACCGATTGTCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-204s1c1
Sequence:CCGGGAATACCAGGAATACTTGAAACTCGAGTTTCAAGTATTCCTGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-195s1c1
Sequence:CCGGGATGACAAAGAATACCAGGAACTCGAGTTCCTGGTATTCTTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-435s1c1
Sequence:CCGGCAACAACAGTACACACAGTATCTCGAGATACTGTGTGTACTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-425s1c1
Sequence:CCGGGCCCTACTATCAACAACAGTACTCGAGTACTGTTGTTGATAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025997
FAM103A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 103, member A1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025997.2-1008s1c1
Sequence:CCGGGAACTGCTTTGGTCCTATATGCTCGAGCATATAGGACCAAAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025997.2-972s21c1
Sequence:CCGGCATGGTGTCTTGTGGTTTATACTCGAGTATAAACCACAAGACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-351s21c1
Sequence:CCGGCCAAGTGACAATCGGTCAAATCTCGAGATTTGACCGATTGTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-415s21c1
Sequence:CCGGAGAGACCAGAGCCCTACTATCCTCGAGGATAGTAGGGCTCTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-329s21c1
Sequence:CCGGTAGGGATAACAGACGAGGATGCTCGAGCATCCTCGTCTGTTATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025997.2-304s21c1
Sequence:CCGGTGCAAGACAACAGACAATTTACTCGAGTAAATTGTCTGTTGTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025997.1-420s1c1
Sequence:CCGGCCAGAGCCCTACTATCAACAACTCGAGTTGTTGATAGTAGGGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025997.1-350s1c1
Sequence:CCGGGCCAAGTGACAATCGGTCAAACTCGAGTTTGACCGATTGTCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-204s1c1
Sequence:CCGGGAATACCAGGAATACTTGAAACTCGAGTTTCAAGTATTCCTGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-195s1c1
Sequence:CCGGGATGACAAAGAATACCAGGAACTCGAGTTCCTGGTATTCTTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-435s1c1
Sequence:CCGGCAACAACAGTACACACAGTATCTCGAGATACTGTGTGTACTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025997.1-425s1c1
Sequence:CCGGGCCCTACTATCAACAACAGTACTCGAGTACTGTTGTTGATAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks