EMAIL THIS PAGE TO A FRIEND

FAM104A

family with sequence similarity 104, member A

113 Gene Product Result for
UniProtKB ID: Q969W3, B4E339
Gene ID:
Mouse(28081) family with sequence similarity 104, member A
Rat(619573) family with sequence similarity 104, member A
chicken(417450) family with sequence similarity 104, member A
domestic cat(101091486) family with sequence similarity 104, member A
cow(615081) family with sequence similarity 104, member A
dog(475906) family with sequence similarity 104, member A
domestic guinea pig(100721864) family with sequence similarity 104, member A
naked mole-rat(101718173) family with sequence similarity 104, member A
sheep(101113606) family with sequence similarity 104, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032837 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025141 MISSION® esiRNA esiRNA human FAM104A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098832 Rosetta Predictions human pricing
NM_032837 Rosetta Predictions human pricing
NM_001034958 Rosetta Predictions rat pricing
NM_138598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320124 predicted 842
2 SASI_Hs02_00320125 predicted 844
3 SASI_Hs02_00320126 predicted 844
4 SASI_Hs02_00320127 predicted 749
5 SASI_Hs02_00320128 predicted 311
6 SASI_Hs02_00320129 predicted 700
7 SASI_Hs02_00320130 predicted 1010
8 SASI_Hs02_00320131 predicted 321
9 SASI_Hs02_00320132 predicted 1017
10 SASI_Hs02_00320133 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038189 predicted 779
2 SASI_Hs01_00038190 predicted 781
3 SASI_Hs01_00038191 predicted 775
4 SASI_Hs01_00038192 predicted 691
5 SASI_Hs01_00038194 predicted 312
6 SASI_Hs01_00038195 predicted 639
7 SASI_Hs01_00038196 predicted 949
8 SASI_Hs01_00038197 predicted 327
9 SASI_Hs02_00360434 predicted 959
10 SASI_Hs01_00038198 predicted 1139
11 SASI_Hs01_00038193 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095045 predicted 375
2 SASI_Rn01_00095037 predicted 343
3 SASI_Rn01_00095038 predicted 463
4 SASI_Rn01_00095039 predicted 584
5 SASI_Rn01_00095040 predicted 411
6 SASI_Rn01_00095041 predicted 408
7 SASI_Rn01_00095042 predicted 717
8 SASI_Rn01_00095043 predicted 338
9 SASI_Rn01_00095044 predicted 684
10 SASI_Rn01_00095046 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043059 predicted 298
2 SASI_Mm01_00043060 predicted 1056
3 SASI_Mm02_00339665 predicted 123
4 SASI_Mm02_00339666 predicted 1104
5 SASI_Mm01_00043054 predicted 376
6 SASI_Mm01_00043055 predicted 906
7 SASI_Mm01_00043056 predicted 665
8 SASI_Mm02_00339667 predicted 959
9 SASI_Mm01_00043061 predicted 564
10 SASI_Mm01_00043062 predicted 576
11 SASI_Mm01_00043057 predicted 522
12 SASI_Mm01_00043058 predicted 1000
13 SASI_Mm01_00043063 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138598
FAM104A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 104, member A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138598.2-179s1c1
Sequence:CCGGGAGAAGAAATGGCAGTGATGACTCGAGTCATCACTGCCATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138598.5-664s21c1
Sequence:CCGGCACTGTGCAGATTGGATATTTCTCGAGAAATATCCAATCTGCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-621s21c1
Sequence:CCGGATGATGCTCCTCCGGCAGTTTCTCGAGAAACTGCCGGAGGAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-389s21c1
Sequence:CCGGAGTCTTCAAGCAGCGACAGTGCTCGAGCACTGTCGCTGCTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-534s21c1
Sequence:CCGGACTATGCCAAGGCCCTTACTTCTCGAGAAGTAAGGGCCTTGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-573s21c1
Sequence:CCGGGAAGGAGGCTCACTTTCATAGCTCGAGCTATGAAAGTGAGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138598
FAM104A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 104, member A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138598.2-179s1c1
Sequence:CCGGGAGAAGAAATGGCAGTGATGACTCGAGTCATCACTGCCATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138598.5-664s21c1
Sequence:CCGGCACTGTGCAGATTGGATATTTCTCGAGAAATATCCAATCTGCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-621s21c1
Sequence:CCGGATGATGCTCCTCCGGCAGTTTCTCGAGAAACTGCCGGAGGAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-389s21c1
Sequence:CCGGAGTCTTCAAGCAGCGACAGTGCTCGAGCACTGTCGCTGCTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-534s21c1
Sequence:CCGGACTATGCCAAGGCCCTTACTTCTCGAGAAGTAAGGGCCTTGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-573s21c1
Sequence:CCGGGAAGGAGGCTCACTTTCATAGCTCGAGCTATGAAAGTGAGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138598
FAM104A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 104, member A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138598.2-179s1c1
Sequence:CCGGGAGAAGAAATGGCAGTGATGACTCGAGTCATCACTGCCATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138598.5-664s21c1
Sequence:CCGGCACTGTGCAGATTGGATATTTCTCGAGAAATATCCAATCTGCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-621s21c1
Sequence:CCGGATGATGCTCCTCCGGCAGTTTCTCGAGAAACTGCCGGAGGAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-389s21c1
Sequence:CCGGAGTCTTCAAGCAGCGACAGTGCTCGAGCACTGTCGCTGCTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-534s21c1
Sequence:CCGGACTATGCCAAGGCCCTTACTTCTCGAGAAGTAAGGGCCTTGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138598.5-573s21c1
Sequence:CCGGGAAGGAGGCTCACTTTCATAGCTCGAGCTATGAAAGTGAGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032837
VALIDATED
FAM104A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 104, member A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032837.1-2154s1c1
Sequence:CCGGGCCAGATTCTTGACAAGGATTCTCGAGAATCCTTGTCAAGAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-207s1c1
Sequence:CCGGGAATGGCAACGAAGAAGACAACTCGAGTTGTCTTCTTCGTTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-213s1c1
Sequence:CCGGCAACGAAGAAGACAACCATCTCTCGAGAGATGGTTGTCTTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-459s1c1
Sequence:CCGGCTACTTCCACATCAACCAGACCTCGAGGTCTGGTTGATGTGGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-251s1c1
Sequence:CCGGGAAGTAGCAGAAACCCTGTCTCTCGAGAGACAGGGTTTCTGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-201s1c1
Sequence:CCGGGAGAAGGAATGGCAACGAAGACTCGAGTCTTCGTTGCCATTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-2011s1c1
Sequence:CCGGGCTAACCTAATGTGGGCAGAACTCGAGTTCTGCCCACATTAGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-212s1c1
Sequence:CCGGGCAACGAAGAAGACAACCATCCTCGAGGATGGTTGTCTTCTTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-203s1c1
Sequence:CCGGGAAGGAATGGCAACGAAGAAGCTCGAGCTTCTTCGTTGCCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-254s1c1
Sequence:CCGGGTAGCAGAAACCCTGTCTTTCCTCGAGGAAAGACAGGGTTTCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032837.1-2207s1c1
Sequence:CCGGCGGAAAGGATACACTGCTAATCTCGAGATTAGCAGTGTATCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-1067s1c1
Sequence:CCGGCCTGTGTAACAGGAGAACAATCTCGAGATTGTTCTCCTGTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-679s1c1
Sequence:CCGGGCAGTTGTTTACTTGTGGTTTCTCGAGAAACCACAAGTAAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032837.1-2358s1c1
Sequence:CCGGCGTACTGAAATGAAACGTGTACTCGAGTACACGTTTCATTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032837
VALIDATED
FAM104A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 104, member A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032837.1-2154s1c1
Sequence:CCGGGCCAGATTCTTGACAAGGATTCTCGAGAATCCTTGTCAAGAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-207s1c1
Sequence:CCGGGAATGGCAACGAAGAAGACAACTCGAGTTGTCTTCTTCGTTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-213s1c1
Sequence:CCGGCAACGAAGAAGACAACCATCTCTCGAGAGATGGTTGTCTTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-459s1c1
Sequence:CCGGCTACTTCCACATCAACCAGACCTCGAGGTCTGGTTGATGTGGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-251s1c1
Sequence:CCGGGAAGTAGCAGAAACCCTGTCTCTCGAGAGACAGGGTTTCTGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-201s1c1
Sequence:CCGGGAGAAGGAATGGCAACGAAGACTCGAGTCTTCGTTGCCATTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-2011s1c1
Sequence:CCGGGCTAACCTAATGTGGGCAGAACTCGAGTTCTGCCCACATTAGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-212s1c1
Sequence:CCGGGCAACGAAGAAGACAACCATCCTCGAGGATGGTTGTCTTCTTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-203s1c1
Sequence:CCGGGAAGGAATGGCAACGAAGAAGCTCGAGCTTCTTCGTTGCCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-254s1c1
Sequence:CCGGGTAGCAGAAACCCTGTCTTTCCTCGAGGAAAGACAGGGTTTCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032837.1-2207s1c1
Sequence:CCGGCGGAAAGGATACACTGCTAATCTCGAGATTAGCAGTGTATCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-1067s1c1
Sequence:CCGGCCTGTGTAACAGGAGAACAATCTCGAGATTGTTCTCCTGTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-679s1c1
Sequence:CCGGGCAGTTGTTTACTTGTGGTTTCTCGAGAAACCACAAGTAAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032837.1-2358s1c1
Sequence:CCGGCGTACTGAAATGAAACGTGTACTCGAGTACACGTTTCATTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032837
VALIDATED
FAM104A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 104, member A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032837.1-2154s1c1
Sequence:CCGGGCCAGATTCTTGACAAGGATTCTCGAGAATCCTTGTCAAGAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-207s1c1
Sequence:CCGGGAATGGCAACGAAGAAGACAACTCGAGTTGTCTTCTTCGTTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-213s1c1
Sequence:CCGGCAACGAAGAAGACAACCATCTCTCGAGAGATGGTTGTCTTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-459s1c1
Sequence:CCGGCTACTTCCACATCAACCAGACCTCGAGGTCTGGTTGATGTGGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-251s1c1
Sequence:CCGGGAAGTAGCAGAAACCCTGTCTCTCGAGAGACAGGGTTTCTGCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-201s1c1
Sequence:CCGGGAGAAGGAATGGCAACGAAGACTCGAGTCTTCGTTGCCATTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-2011s1c1
Sequence:CCGGGCTAACCTAATGTGGGCAGAACTCGAGTTCTGCCCACATTAGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-212s1c1
Sequence:CCGGGCAACGAAGAAGACAACCATCCTCGAGGATGGTTGTCTTCTTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-203s1c1
Sequence:CCGGGAAGGAATGGCAACGAAGAAGCTCGAGCTTCTTCGTTGCCATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032837.1-254s1c1
Sequence:CCGGGTAGCAGAAACCCTGTCTTTCCTCGAGGAAAGACAGGGTTTCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032837.1-2207s1c1
Sequence:CCGGCGGAAAGGATACACTGCTAATCTCGAGATTAGCAGTGTATCCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-1067s1c1
Sequence:CCGGCCTGTGTAACAGGAGAACAATCTCGAGATTGTTCTCCTGTTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032837.1-679s1c1
Sequence:CCGGGCAGTTGTTTACTTGTGGTTTCTCGAGAAACCACAAGTAAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032837.1-2358s1c1
Sequence:CCGGCGTACTGAAATGAAACGTGTACTCGAGTACACGTTTCATTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks