EMAIL THIS PAGE TO A FRIEND

FAM104B

family with sequence similarity 104, member B

30 Gene Product Result for
Synonyms: CXorf44
Species: Human FAM104B(90736)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301437 ANTI-FAM104B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138362 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052321 MISSION® esiRNA esiRNA human FAM104B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138362 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196961 predicted 211
2 SASI_Hs01_00196962 predicted 211
3 SASI_Hs01_00196963 predicted 199
4 SASI_Hs01_00196964 predicted 194
5 SASI_Hs01_00196965 predicted 207
6 SASI_Hs01_00196967 predicted 288
7 SASI_Hs01_00196968 predicted 264
8 SASI_Hs01_00196969 predicted 382
9 SASI_Hs01_00196970 predicted 279
10 SASI_Hs02_00363461 predicted 384
11 SASI_Hs01_00196966 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138362
FAM104B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 104, member B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-261s1c1
Sequence:CCGGCCAGTTCTTGCATGAGGGATTCTCGAGAATCCCTCATGCAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138362.1-229s1c1
Sequence:CCGGCAGATTGTTACTGAACCCGATCTCGAGATCGGGTTCAGTAACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-214s1c1
Sequence:CCGGGAAGGCAACTTAAACCAGATTCTCGAGAATCTGGTTTAAGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-274s1c1
Sequence:CCGGGAGGGATTGTCTAAACCTGTTCTCGAGAACAGGTTTAGACAATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-115s1c1
Sequence:CCGGCCTATCTTTCAGGATTCTCAACTCGAGTTGAGAATCCTGAAAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-181s1c1
Sequence:CCGGCGCATTAATATCCCAGAGAGACTCGAGTCTCTCTGGGATATTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138362
FAM104B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 104, member B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-261s1c1
Sequence:CCGGCCAGTTCTTGCATGAGGGATTCTCGAGAATCCCTCATGCAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138362.1-229s1c1
Sequence:CCGGCAGATTGTTACTGAACCCGATCTCGAGATCGGGTTCAGTAACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-214s1c1
Sequence:CCGGGAAGGCAACTTAAACCAGATTCTCGAGAATCTGGTTTAAGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-274s1c1
Sequence:CCGGGAGGGATTGTCTAAACCTGTTCTCGAGAACAGGTTTAGACAATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-115s1c1
Sequence:CCGGCCTATCTTTCAGGATTCTCAACTCGAGTTGAGAATCCTGAAAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-181s1c1
Sequence:CCGGCGCATTAATATCCCAGAGAGACTCGAGTCTCTCTGGGATATTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138362
FAM104B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 104, member B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-261s1c1
Sequence:CCGGCCAGTTCTTGCATGAGGGATTCTCGAGAATCCCTCATGCAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138362.1-229s1c1
Sequence:CCGGCAGATTGTTACTGAACCCGATCTCGAGATCGGGTTCAGTAACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-214s1c1
Sequence:CCGGGAAGGCAACTTAAACCAGATTCTCGAGAATCTGGTTTAAGTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-274s1c1
Sequence:CCGGGAGGGATTGTCTAAACCTGTTCTCGAGAACAGGTTTAGACAATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-115s1c1
Sequence:CCGGCCTATCTTTCAGGATTCTCAACTCGAGTTGAGAATCCTGAAAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138362.1-181s1c1
Sequence:CCGGCGCATTAATATCCCAGAGAGACTCGAGTCTCTCTGGGATATTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks