EMAIL THIS PAGE TO A FRIEND

FAM105A

family with sequence similarity 105, member A

Synonyms: NET20
UniProtKB ID: Q9NUU6, Q53H50, Q9H037
Gene ID:
Mouse(223433) family with sequence similarity 105, member A
Rat(310190) family with sequence similarity 105, member A
chicken(769855) family with sequence similarity 105, member A
cow(534389) family with sequence similarity 105, member A
domestic cat(101090920) family with sequence similarity 105, member A
sheep(101103673) family with sequence similarity 105, member A
naked mole-rat(101698952) family with sequence similarity 105, member A
domestic guinea pig(100719490) family with sequence similarity 105, member A
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019018 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU179931 MISSION® esiRNA esiRNA targeting mouse Fam105a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019018 Rosetta Predictions human pricing
NM_001037648 Rosetta Predictions rat pricing
NM_198301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123230 predicted 474
2 SASI_Hs01_00123231 predicted 794
3 SASI_Hs01_00123232 predicted 905
4 SASI_Hs01_00123233 predicted 458
5 SASI_Hs01_00123234 predicted 348
6 SASI_Hs02_00352548 predicted 207
7 SASI_Hs01_00123236 predicted 897
8 SASI_Hs01_00123237 predicted 1009
9 SASI_Hs01_00123238 predicted 733
10 SASI_Hs02_00352549 predicted 927
11 SASI_Hs01_00123229 predicted 416
12 SASI_Hs01_00123235 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065994 predicted 560
2 SASI_Rn01_00065995 predicted 282
3 SASI_Rn01_00065996 predicted 790
4 SASI_Rn01_00065997 predicted 950
5 SASI_Rn01_00065998 predicted 981
6 SASI_Rn01_00065999 predicted 494
7 SASI_Rn01_00066000 predicted 479
8 SASI_Rn01_00066001 predicted 1017
9 SASI_Rn02_00204520 predicted 403
10 SASI_Rn01_00066002 predicted 923
11 SASI_Rn01_00066003 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163245 predicted 772
2 SASI_Mm01_00163246 predicted 719
3 SASI_Mm01_00163247 predicted 305
4 SASI_Mm01_00163249 predicted 408
5 SASI_Mm01_00163250 predicted 969
6 SASI_Mm01_00163251 predicted 798
7 SASI_Mm01_00163252 predicted 832
8 SASI_Mm01_00163253 predicted 725
9 SASI_Mm01_00163254 predicted 261
10 SASI_Mm02_00350933 predicted 533
11 SASI_Mm01_00163248 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198301
FAM105A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 105, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198301.1-129s1c1
Sequence:CCGGCTAGTTACAAGCCAAGTCCTTCTCGAGAAGGACTTGGCTTGTAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198301.1-1472s1c1
Sequence:CCGGGCAAACAACCTCTGGTTTGTACTCGAGTACAAACCAGAGGTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198301.1-608s1c1
Sequence:CCGGCGAAGCTTTGAAGTTCCTCATCTCGAGATGAGGAACTTCAAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-833s21c1
Sequence:CCGGGTTTCGACTGTTCAAGTTTAACTCGAGTTAAACTTGAACAGTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198301.1-1285s21c1
Sequence:CCGGGATTTGGAACAATCGTAAATACTCGAGTATTTACGATTGTTCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-660s21c1
Sequence:CCGGATGAAGACCAACAAGGTTATCCTCGAGGATAACCTTGTTGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-582s21c1
Sequence:CCGGGACGCCATCCTGGAGTGTAAACTCGAGTTTACACTCCAGGATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-803s21c1
Sequence:CCGGCGGGTATTCTCTTCAAGTAAACTCGAGTTTACTTGAAGAGAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198301
FAM105A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 105, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198301.1-129s1c1
Sequence:CCGGCTAGTTACAAGCCAAGTCCTTCTCGAGAAGGACTTGGCTTGTAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198301.1-1472s1c1
Sequence:CCGGGCAAACAACCTCTGGTTTGTACTCGAGTACAAACCAGAGGTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198301.1-608s1c1
Sequence:CCGGCGAAGCTTTGAAGTTCCTCATCTCGAGATGAGGAACTTCAAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-833s21c1
Sequence:CCGGGTTTCGACTGTTCAAGTTTAACTCGAGTTAAACTTGAACAGTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198301.1-1285s21c1
Sequence:CCGGGATTTGGAACAATCGTAAATACTCGAGTATTTACGATTGTTCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-660s21c1
Sequence:CCGGATGAAGACCAACAAGGTTATCCTCGAGGATAACCTTGTTGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-582s21c1
Sequence:CCGGGACGCCATCCTGGAGTGTAAACTCGAGTTTACACTCCAGGATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-803s21c1
Sequence:CCGGCGGGTATTCTCTTCAAGTAAACTCGAGTTTACTTGAAGAGAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198301
FAM105A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 105, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198301.1-129s1c1
Sequence:CCGGCTAGTTACAAGCCAAGTCCTTCTCGAGAAGGACTTGGCTTGTAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198301.1-1472s1c1
Sequence:CCGGGCAAACAACCTCTGGTTTGTACTCGAGTACAAACCAGAGGTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198301.1-608s1c1
Sequence:CCGGCGAAGCTTTGAAGTTCCTCATCTCGAGATGAGGAACTTCAAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-833s21c1
Sequence:CCGGGTTTCGACTGTTCAAGTTTAACTCGAGTTAAACTTGAACAGTCGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198301.1-1285s21c1
Sequence:CCGGGATTTGGAACAATCGTAAATACTCGAGTATTTACGATTGTTCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-660s21c1
Sequence:CCGGATGAAGACCAACAAGGTTATCCTCGAGGATAACCTTGTTGGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-582s21c1
Sequence:CCGGGACGCCATCCTGGAGTGTAAACTCGAGTTTACACTCCAGGATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198301.1-803s21c1
Sequence:CCGGCGGGTATTCTCTTCAAGTAAACTCGAGTTTACTTGAAGAGAATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019018
VALIDATED
FAM105A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 105, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019018.1-667s1c1
Sequence:CCGGCTACGGAAATATGTGGAATTACTCGAGTAATTCCACATATTTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019018.1-1119s1c1
Sequence:CCGGCCACTACCACATTCCAGTCTTCTCGAGAAGACTGGAATGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019018.1-766s1c1
Sequence:CCGGGATGCCATTCTGGAATATAAACTCGAGTTTATATTCCAGAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019018.1-347s1c1
Sequence:CCGGCAGAGGTTGATTTACTCAGTTCTCGAGAACTGAGTAAATCAACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-858s21c1
Sequence:CCGGTATCAAGTCACTGAAGTTTATCTCGAGATAAACTTCAGTGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019018.2-998s21c1
Sequence:CCGGTGGACTAGAGCAGATTGATATCTCGAGATATCAATCTGCTCTAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-1160s21c1
Sequence:CCGGCCACTACCACATTCCAGTCTTCTCGAGAAGACTGGAATGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-531s21c1
Sequence:CCGGGCTCTCAGATCAGTGTTATTTCTCGAGAAATAACACTGATCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-1372s21c1
Sequence:CCGGAGCAGCTGCACTGATACATTTCTCGAGAAATGTATCAGTGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019018
VALIDATED
FAM105A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 105, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019018.1-667s1c1
Sequence:CCGGCTACGGAAATATGTGGAATTACTCGAGTAATTCCACATATTTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019018.1-1119s1c1
Sequence:CCGGCCACTACCACATTCCAGTCTTCTCGAGAAGACTGGAATGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019018.1-766s1c1
Sequence:CCGGGATGCCATTCTGGAATATAAACTCGAGTTTATATTCCAGAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019018.1-347s1c1
Sequence:CCGGCAGAGGTTGATTTACTCAGTTCTCGAGAACTGAGTAAATCAACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-858s21c1
Sequence:CCGGTATCAAGTCACTGAAGTTTATCTCGAGATAAACTTCAGTGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019018.2-998s21c1
Sequence:CCGGTGGACTAGAGCAGATTGATATCTCGAGATATCAATCTGCTCTAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-1160s21c1
Sequence:CCGGCCACTACCACATTCCAGTCTTCTCGAGAAGACTGGAATGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-531s21c1
Sequence:CCGGGCTCTCAGATCAGTGTTATTTCTCGAGAAATAACACTGATCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-1372s21c1
Sequence:CCGGAGCAGCTGCACTGATACATTTCTCGAGAAATGTATCAGTGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019018
VALIDATED
FAM105A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 105, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019018.1-667s1c1
Sequence:CCGGCTACGGAAATATGTGGAATTACTCGAGTAATTCCACATATTTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019018.1-1119s1c1
Sequence:CCGGCCACTACCACATTCCAGTCTTCTCGAGAAGACTGGAATGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019018.1-766s1c1
Sequence:CCGGGATGCCATTCTGGAATATAAACTCGAGTTTATATTCCAGAATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019018.1-347s1c1
Sequence:CCGGCAGAGGTTGATTTACTCAGTTCTCGAGAACTGAGTAAATCAACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-858s21c1
Sequence:CCGGTATCAAGTCACTGAAGTTTATCTCGAGATAAACTTCAGTGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019018.2-998s21c1
Sequence:CCGGTGGACTAGAGCAGATTGATATCTCGAGATATCAATCTGCTCTAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-1160s21c1
Sequence:CCGGCCACTACCACATTCCAGTCTTCTCGAGAAGACTGGAATGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-531s21c1
Sequence:CCGGGCTCTCAGATCAGTGTTATTTCTCGAGAAATAACACTGATCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019018.2-1372s21c1
Sequence:CCGGAGCAGCTGCACTGATACATTTCTCGAGAAATGTATCAGTGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks