EMAIL THIS PAGE TO A FRIEND

FAM105B

family with sequence similarity 105, member B

54 Gene Product Result for
UniProtKB ID: Q96BN8, D3DTD3, Q8NAS0, Q96IA3
Gene ID:
Mouse(432940) family with sequence similarity 105, member B
Rat(100362554) family with sequence similarity 105, member B
domestic guinea pig(100734234) family with sequence similarity 105, member B
naked mole-rat(101699541) family with sequence similarity 105, member B
sheep(101120357) family with sequence similarity 105, member B
chicken(427097) family with sequence similarity 105, member B
cow(508963) family with sequence similarity 105, member B
domestic cat(101090671) family with sequence similarity 105, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301125 ANTI-FAM105B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
HPA051074 Anti-OTULIN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138348 Rosetta Predictions human pricing
NM_001013792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040467 predicted 666
2 SASI_Hs01_00040468 predicted 659
3 SASI_Hs02_00363440 predicted 525
4 SASI_Hs01_00040470 predicted 658
5 SASI_Hs01_00040471 predicted 805
6 SASI_Hs01_00040472 predicted 684
7 SASI_Hs02_00363441 predicted 921
8 SASI_Hs01_00040473 predicted 1070
9 SASI_Hs01_00040474 predicted 1198
10 SASI_Hs01_00040475 predicted 629
11 SASI_Hs01_00040469 predicted 374
12 SASI_Hs01_00040476 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287357 predicted 273
2 SASI_Mm01_00062426 predicted 769
3 SASI_Mm01_00062427 predicted 604
4 SASI_Mm01_00062430 predicted 720
5 SASI_Mm02_00287358 predicted 271
6 SASI_Mm02_00287359 predicted 305
7 SASI_Mm02_00287360 predicted 339
8 SASI_Mm02_00287361 predicted 239
9 SASI_Mm02_00287362 predicted 606
10 SASI_Mm02_00287363 predicted 376
11 SASI_Mm01_00062425 predicted 287
12 SASI_Mm01_00062428 predicted 851
13 SASI_Mm01_00062429 predicted 685
14 SASI_Mm01_00062431 predicted 699
15 SASI_Mm01_00062432 predicted 360
16 SASI_Mm01_00062433 predicted 255
17 SASI_Mm01_00062434 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013792
VALIDATED
FAM105B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 105, member B
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-765s21c1
Sequence:CCGGCCTCTACGAAGCTGTGAAGTTCTCGAGAACTTCACAGCTTCGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-592s21c1
Sequence:CCGGCAGTGGAAACTTGGACTGAAACTCGAGTTTCAGTCCAAGTTTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013792.2-425s1c1
Sequence:CCGGCTCAGAAATTCACTTCCATAACTCGAGTTATGGAAGTGAATTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013792.2-1276s1c1
Sequence:CCGGGAAGACTAGCTGTTGATAATGCTCGAGCATTATCAACAGCTAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013792.2-1250s1c1
Sequence:CCGGGAGCCAACTTTGGACCATTATCTCGAGATAATGGTCCAAAGTTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-786s21c1
Sequence:CCGGCCTGATGTTAAACAGAGCCATCTCGAGATGGCTCTGTTTAACATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-1085s21c1
Sequence:CCGGCTGAGGATGATCGGCACTATACTCGAGTATAGTGCCGATCATCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-686s1c1
Sequence:CCGGCTGAGGATGATCGGCACTATACTCGAGTATAGTGCCGATCATCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-387s1c1
Sequence:CCGGCCTGATGTTAAACAGAGCCATCTCGAGATGGCTCTGTTTAACATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-366s1c1
Sequence:CCGGCCTCTACGAAGCTGTGAAGTTCTCGAGAACTTCACAGCTTCGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-193s1c1
Sequence:CCGGCAGTGGAAACTTGGACTGAAACTCGAGTTTCAGTCCAAGTTTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013792.1-160s1c1
Sequence:CCGGGAGAAGCTGATAAACAAGTATCTCGAGATACTTGTTTATCAGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-144s1c1
Sequence:CCGGGCTCATACTGTTACCAGAGAACTCGAGTTCTCTGGTAACAGTATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013792
VALIDATED
FAM105B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 105, member B
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-765s21c1
Sequence:CCGGCCTCTACGAAGCTGTGAAGTTCTCGAGAACTTCACAGCTTCGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-592s21c1
Sequence:CCGGCAGTGGAAACTTGGACTGAAACTCGAGTTTCAGTCCAAGTTTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013792.2-425s1c1
Sequence:CCGGCTCAGAAATTCACTTCCATAACTCGAGTTATGGAAGTGAATTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013792.2-1276s1c1
Sequence:CCGGGAAGACTAGCTGTTGATAATGCTCGAGCATTATCAACAGCTAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013792.2-1250s1c1
Sequence:CCGGGAGCCAACTTTGGACCATTATCTCGAGATAATGGTCCAAAGTTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-786s21c1
Sequence:CCGGCCTGATGTTAAACAGAGCCATCTCGAGATGGCTCTGTTTAACATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-1085s21c1
Sequence:CCGGCTGAGGATGATCGGCACTATACTCGAGTATAGTGCCGATCATCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-686s1c1
Sequence:CCGGCTGAGGATGATCGGCACTATACTCGAGTATAGTGCCGATCATCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-387s1c1
Sequence:CCGGCCTGATGTTAAACAGAGCCATCTCGAGATGGCTCTGTTTAACATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-366s1c1
Sequence:CCGGCCTCTACGAAGCTGTGAAGTTCTCGAGAACTTCACAGCTTCGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-193s1c1
Sequence:CCGGCAGTGGAAACTTGGACTGAAACTCGAGTTTCAGTCCAAGTTTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013792.1-160s1c1
Sequence:CCGGGAGAAGCTGATAAACAAGTATCTCGAGATACTTGTTTATCAGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-144s1c1
Sequence:CCGGGCTCATACTGTTACCAGAGAACTCGAGTTCTCTGGTAACAGTATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013792
VALIDATED
FAM105B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 105, member B
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-765s21c1
Sequence:CCGGCCTCTACGAAGCTGTGAAGTTCTCGAGAACTTCACAGCTTCGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-592s21c1
Sequence:CCGGCAGTGGAAACTTGGACTGAAACTCGAGTTTCAGTCCAAGTTTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013792.2-425s1c1
Sequence:CCGGCTCAGAAATTCACTTCCATAACTCGAGTTATGGAAGTGAATTTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217453    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013792.2-1276s1c1
Sequence:CCGGGAAGACTAGCTGTTGATAATGCTCGAGCATTATCAACAGCTAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013792.2-1250s1c1
Sequence:CCGGGAGCCAACTTTGGACCATTATCTCGAGATAATGGTCCAAAGTTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-786s21c1
Sequence:CCGGCCTGATGTTAAACAGAGCCATCTCGAGATGGCTCTGTTTAACATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013792.2-1085s21c1
Sequence:CCGGCTGAGGATGATCGGCACTATACTCGAGTATAGTGCCGATCATCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-686s1c1
Sequence:CCGGCTGAGGATGATCGGCACTATACTCGAGTATAGTGCCGATCATCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-387s1c1
Sequence:CCGGCCTGATGTTAAACAGAGCCATCTCGAGATGGCTCTGTTTAACATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-366s1c1
Sequence:CCGGCCTCTACGAAGCTGTGAAGTTCTCGAGAACTTCACAGCTTCGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-193s1c1
Sequence:CCGGCAGTGGAAACTTGGACTGAAACTCGAGTTTCAGTCCAAGTTTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013792.1-160s1c1
Sequence:CCGGGAGAAGCTGATAAACAAGTATCTCGAGATACTTGTTTATCAGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013792.1-144s1c1
Sequence:CCGGGCTCATACTGTTACCAGAGAACTCGAGTTCTCTGGTAACAGTATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138348
VALIDATED
FAM105B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 105, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-1396s21c1
Sequence:CCGGCCCTCATCTATGATGCAATATCTCGAGATATTGCATCATAGATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-374s21c1
Sequence:CCGGGGCATCAGAACCGAGATTAAGCTCGAGCTTAATCTCGGTTCTGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-659s21c1
Sequence:CCGGGCAATGGAAACTTGGACTGAACTCGAGTTCAGTCCAAGTTTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138348.4-865s21c1
Sequence:CCGGACAGAGCCATTGAACTATATACTCGAGTATATAGTTCAATGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138348.4-1011s21c1
Sequence:CCGGGAACAGGTTGAAATGTTCCTTCTCGAGAAGGAACATTTCAACCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-1176s1c1
Sequence:CCGGCCCTTTAGTAGTAACGGGTTTCTCGAGAAACCCGTTACTACTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-584s1c1
Sequence:CCGGGAACAGGTTGAAATGTTCCTTCTCGAGAAGGAACATTTCAACCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-593s1c1
Sequence:CCGGGAAATGTTCCTTCTTGCCTATCTCGAGATAGGCAAGAAGGAACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-232s1c1
Sequence:CCGGGCAATGGAAACTTGGACTGAACTCGAGTTCAGTCCAAGTTTCCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138348.3-576s1c1
Sequence:CCGGGTGGTCTTGAACAGGTTGAAACTCGAGTTTCAACCTGTTCAAGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138348
VALIDATED
FAM105B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 105, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-1396s21c1
Sequence:CCGGCCCTCATCTATGATGCAATATCTCGAGATATTGCATCATAGATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-374s21c1
Sequence:CCGGGGCATCAGAACCGAGATTAAGCTCGAGCTTAATCTCGGTTCTGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-659s21c1
Sequence:CCGGGCAATGGAAACTTGGACTGAACTCGAGTTCAGTCCAAGTTTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138348.4-865s21c1
Sequence:CCGGACAGAGCCATTGAACTATATACTCGAGTATATAGTTCAATGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138348.4-1011s21c1
Sequence:CCGGGAACAGGTTGAAATGTTCCTTCTCGAGAAGGAACATTTCAACCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-1176s1c1
Sequence:CCGGCCCTTTAGTAGTAACGGGTTTCTCGAGAAACCCGTTACTACTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-584s1c1
Sequence:CCGGGAACAGGTTGAAATGTTCCTTCTCGAGAAGGAACATTTCAACCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-593s1c1
Sequence:CCGGGAAATGTTCCTTCTTGCCTATCTCGAGATAGGCAAGAAGGAACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-232s1c1
Sequence:CCGGGCAATGGAAACTTGGACTGAACTCGAGTTCAGTCCAAGTTTCCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138348.3-576s1c1
Sequence:CCGGGTGGTCTTGAACAGGTTGAAACTCGAGTTTCAACCTGTTCAAGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138348
VALIDATED
FAM105B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 105, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-1396s21c1
Sequence:CCGGCCCTCATCTATGATGCAATATCTCGAGATATTGCATCATAGATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-374s21c1
Sequence:CCGGGGCATCAGAACCGAGATTAAGCTCGAGCTTAATCTCGGTTCTGATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_138348.4-659s21c1
Sequence:CCGGGCAATGGAAACTTGGACTGAACTCGAGTTCAGTCCAAGTTTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138348.4-865s21c1
Sequence:CCGGACAGAGCCATTGAACTATATACTCGAGTATATAGTTCAATGGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138348.4-1011s21c1
Sequence:CCGGGAACAGGTTGAAATGTTCCTTCTCGAGAAGGAACATTTCAACCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-1176s1c1
Sequence:CCGGCCCTTTAGTAGTAACGGGTTTCTCGAGAAACCCGTTACTACTAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-584s1c1
Sequence:CCGGGAACAGGTTGAAATGTTCCTTCTCGAGAAGGAACATTTCAACCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-593s1c1
Sequence:CCGGGAAATGTTCCTTCTTGCCTATCTCGAGATAGGCAAGAAGGAACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138348.3-232s1c1
Sequence:CCGGGCAATGGAAACTTGGACTGAACTCGAGTTCAGTCCAAGTTTCCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138348.3-576s1c1
Sequence:CCGGGTGGTCTTGAACAGGTTGAAACTCGAGTTTCAACCTGTTCAAGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)